Evidence for nonallopatric speciation among closely related sympatric Heliotropium species in the Atacama Desert

The genetic structure of populations of closely related, sympatric species may hold the signature of the geographical mode of the speciation process. In fully allopatric speciation, it is expected that genetic differentiation between species is homogeneously distributed across the genome. In nonallopatric speciation, the genomes may remain undifferentiated to a large extent. In this article, we analyzed the genetic structure of five sympatric species from the plant genus Heliotropium in the Atacama Desert. We used amplified fragment length polymorphisms (AFLPs) to characterize the genetic structure of these species and evaluate their genetic differentiation as well as the number of loci subject to positive selection using divergence outlier analysis (DOA). The five species form distinguishable groups in the genetic space, with zones of overlap, indicating that they are possibly not completely isolated. Among‐species differentiation accounts for 35% of the total genetic differentiation (F_ST = 0.35), and F_ST between species pairs is positively correlated with phylogenetic distance. DOA suggests that few loci are subject to positive selection, which is in line with a scenario of nonallopatric speciation. These results support the idea that sympatric species of Heliotropium sect. Cochranea are under an ongoing speciation process, characterized by a fluctuation of population ranges in response to pulses of arid and humid periods during Quaternary times.     

1,5-Benzodiazepine inhibitors of HCV NS5B polymerase

Optimization through parallel synthesis of a novel series of hepatitis C virus (HCV) NS5B polymerase inhibitors led to the identification of (R)-11-(4-benzyloxy-2-fluorophenyl)-6-hydroxy-3,3-dimethyl-10-(6-methylpyridine-2-carbonyl)-2,3,4,5,10,11-hexahydro-dibenzo[b,e][1,4]diazepin-1-one 11zc and (R)-11-(4-benzyloxy-2-fluorophenyl)-6-hydroxy-3,3-dimethyl-10-(2,5-dimethyloxazol-4-carbonyl)-2,3,4,5,10,11-hexahydro-dibenzo[b,e][1,4]diazepin-1-one 11zk as potent (replicon EC₅₀ = 400 nM and 270 nM, respectively) and selective (CC₅₀ > 20 μM) inhibitors of HCV replication. These data warrant further lead-optimization efforts.     

The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU _OH.     

Relating neuromuscular control to functional anatomy of limb muscles in extant archosaurs

Electromyography (EMG) is used to understand muscle activity patterns in animals. Understanding how much variation exists in muscle activity patterns in homologous muscles across animal clades during similar behaviours is important for evaluating the evolution of muscle functions and neuromuscular control. We compared muscle activity across a range of archosaurian species and appendicular muscles, including how these EMG patterns varied across ontogeny and phylogeny, to reconstruct the evolutionary history of archosaurian muscle activation during locomotion. EMG electrodes were implanted into the muscles of turkeys, pheasants, quail, guineafowl, emus (three age classes), tinamous and juvenile Nile crocodiles across 13 different appendicular muscles. Subjects walked and ran at a range of speeds both overground and on treadmills during EMG recordings. Anatomically similar muscles such as the lateral gastrocnemius exhibited similar EMG patterns at similar relative speeds across all birds. In the crocodiles, the EMG signals closely matched previously published data for alligators. The timing of lateral gastrocnemius activation was relatively later within a stride cycle for crocodiles compared to birds. This difference may relate to the coordinated knee extension and ankle plantarflexion timing across the swing-stance transition in Crocodylia, unlike in birds where there is knee flexion and ankle dorsiflexion across swing-stance. No significant effects were found across the species for ontogeny, or between treadmill and overground locomotion. Our findings strengthen the inference that some muscle EMG patterns remained conservative throughout Archosauria: for example, digital flexors retained similar stance phase activity and M. pectoralis remained an ‘anti-gravity’ muscle. However, some avian hindlimb muscles evolved divergent activations in tandem with functional changes such as bipedalism and more crouched postures, especially M. iliotrochantericus caudalis switching from swing to stance phase activity and M. iliofibularis adding a novel stance phase burst of activity.     

An improved FORTRAN 77 recombinant DNA database management system with graphic extensions in GKS

We have improved an existing clone database management systemwritten in FORTRAN 77 and adapted it to our software environment.Improvements are that the database can be interrogated for anytype of information, not just keywords. Also, recombinant DNAconstructions can be represented in a simplified ‘shorthand’,whereafter a program assembles the full nucleotide sequencefrom the contributing fragments, which may be obtained fromnucleotide sequence databases. Another improvement is the replacementof the database manager by programs, running in batch to maintainthe databank and verify its consistency automatically. Finally,graphic extensions are written in Graphical Kernel System, todraw linear and circular restriction maps of recombinants. Besidesrestriction sites, recombinant features can be presented fromthe feature lines of recombinant database entries, or from thefeature tables of nucleotide databases. The clone database managementsystem is fully integrated into the sequence analysis softwarepackage from the Pasteur Institute, Paris, and is made accessiblethrough the same menu. As a result, recombinant DNA sequencescan directly be analysed by the sequence analysis programs. Received on March 17, 1986; accepted on June 16, 1986     

Label‐free stimulated Raman scattering imaging reveals silicone breast implant material in tissue

Millions of women worldwide have silicone breast implants. It has been reported that implant failure occurs in approximately a tenth of patients within 10 years, and the consequences of dissemination of silicone debris are poorly understood. Currently, silicone detection in histopathological slides is based on morphological features as no specific immunohistochemical technique is available. Here, we show the feasibility and sensitivity of stimulated Raman scattering (SRS) imaging to specifically detect silicone material in stained histopathological slides, without additional sample treatment. Histology slides of four periprosthetic capsules from different implant types were obtained after explantation, as well as an enlarged axillary lymph node from a patient with a ruptured implant. SRS images coregistered with bright‐field images revealed the distribution and quantity of silicone material in the tissue. Fast and high‐resolution imaging of histology slides with molecular specificity using SRS provides an opportunity to investigate the role of silicone debris in the pathophysiology of implant‐linked diseases.     

Phasing in on the cell cycle

Just like all matter, proteins can also switch between gas, liquid and solid phases. Protein phase transition has claimed the spotlight in recent years as a novel way of how cells compartmentalize and regulate biochemical reactions. Moreover, this discovery has provided a new framework for the study of membrane-less organelle biogenesis and protein aggregation in neurodegenerative disorders. We now argue that this framework could be useful in the study of cell cycle regulation and cancer. Based on our work on phase transitions of arginine-rich proteins in neurodegeneration, via combining mass spectroscopy with bioinformatics analyses, we found that also numerous proteins involved in the regulation of the cell cycle can undergo protein phase separation. Indeed, several proteins whose function affects the cell cycle or are associated with cancer, have been recently found to phase separate from the test tube to cells. Investigating the role of this process for cell cycle proteins and understanding its molecular underpinnings will provide pivotal insights into the biology of cell cycle progression and cancer.     

HDAC6 inhibition restores TDP‐43 pathology and axonal transport defects in human motor neurons with TARDBP mutations

TDP‐43 is the major component of pathological inclusions in most ALS patients and in up to 50% of patients with frontotemporal dementia (FTD). Heterozygous missense mutations in TARDBP, the gene encoding TDP‐43, are one of the common causes of familial ALS. In this study, we investigate TDP‐43 protein behavior in induced pluripotent stem cell (iPSC)‐derived motor neurons from three ALS patients with different TARDBP mutations, three healthy controls and an isogenic control. TARDPB mutations induce several TDP‐43 changes in spinal motor neurons, including cytoplasmic mislocalization and accumulation of insoluble TDP‐43, C‐terminal fragments, and phospho‐TDP‐43. By generating iPSC lines with allele‐specific tagging of TDP‐43, we find that mutant TDP‐43 initiates the observed disease phenotypes and has an altered interactome as indicated by mass spectrometry. Our findings also indicate that TDP‐43 proteinopathy results in a defect in mitochondrial transport. Lastly, we show that pharmacological inhibition of histone deacetylase 6 (HDAC6) restores the observed TDP‐43 pathologies and the axonal mitochondrial motility, suggesting that HDAC6 inhibition may be an interesting therapeutic target for neurodegenerative disorders linked to TDP‐43 pathology.