Biodegradation kinetics of 2,4,6-Trichlorophenol by an acclimated mixed microbial culture under aerobic conditions

The objective of this study was to achieve a better quantitative understanding of the kinetics of 2,4,6-trichlorophenol (TCP) biodegradation by an acclimated mixed microbial culture. An aerobic mixed microbial culture, obtained from the aeration basin of the wastewater treatment plant, was acclimated in shake flasks utilizing various combinations of 2,4,6-TCP (25–100 mg l⁻¹), phenol (300 mg l⁻¹) and glycerol (2.5 mg l⁻¹) as substrates. Complete primary TCP degradation and a corresponding stoichiometric release of chloride ion were observed by HPLC and IEC analytical techniques, respectively. The acclimated cultures were then used as an inoculum for bench scale experiments in a 4 l stirred-tank reactor (STR) with 2,4,6-TCP as the sole carbon/energy (C/E) source. The phenol acclimated mixed microbial culture consisted of primarily Gram positive and negative rods and was capable of degrading 2,4,6-TCP completely. None of the predicted intermediate compounds were detected by gas chromatography in the cell cytoplasm or supernatant. Based on the disappearance of 2,4,6-TCP, degradation was well modelled by zero-order kinetics which was also consistent with the observed oxygen consumption. Biodegradation rates were compared for four operating conditions including two different initial 2,4,6-TCP concentrations and two different initial biomass concentrations. While the specific rate constant was not dependent on the initial 2,4,6-TCP concentration, it did depend on the initial biomass concentration (X _init). A lower biomass concentration gave a much higher zero-order specific degradation rate. This behaviour was attributed to a lower average biomass age or cell retention time (θ_x) for these cultures. The implications of this investigation are important for determining and predicting the potential risks associated with TCP, its degradation in the natural environment or the engineering implications for ex situ treatment of contaminated ground water or soil.     

Purification and Characterization of a Xylanase Produced by Chaetomium thermophile NIBGE

Summary Xylanase was produced by growing Chaetomium thermophile NIBGE in a submerged liquid culture using wheat straw and urea as carbon and nitrogen sources respectively. The xylanase was purified to electrophoretic homogeneity after ammonium sulphate precipitation, anion exchange chromatography by FPLC and gel filtration. The molecular mass of this xylanase BII was 50 kDa. The pH and temperature optima were 6.5 and 70 °C respectively. The xylanase BII showed reasonable stability at high pH and 65 °C temperature. Some metal ions and EDTA caused little inhibition at low concentrations but complete inhibition was observed at concentrations higher than 2 mM. The K_m and V_max values with oat spelt xylan as the substrate were found to be 12.5 mg/ml and 83.3 IU/mg protein, respectively. Liberation of reducing sugars from commercial paper pulp samples suggest the feasibility of a biopulping process using this xylanase.     

Biophysical characterization of DNA aptamer interactions with vascular endothelial growth factor

The binding of a DNA aptamer (5′‐CCGTCTTCCAGACAAGAGTGCAGGG‐3′) to recombinant human vascular endothelial growth factor (VEGF₁₆₅) was characterized using surface plasmon resonance (SPR), fluorescence anisotropy and isothermal titration calorimetry (ITC). Results from both fluorescence anisotropy and ITC indicated that a single aptamer molecule binds to each VEGF homodimer, unlike other VEGF inhibitors that exhibit 2(ligand):1(VEGF homodimer) stoichiometry. In addition, ITC revealed that the association of the aptamer to VEGF at 20°C is enthalpically driven, with an unfavorable entropy contribution. SPR kinetic studies, with careful control of possible mass transfer effects, demonstrated that the aptamer binds to VEGF with an association rate constant k_on = 4.79 ± 0.03 × 10⁴ M^?1 s^?1 and a dissociation rate constant k_off = 5.21 ± 0.02 × 10^?4 s^?1 at 25°C. Key recognition hot‐spots were determined by a combination of aptamer sequence substitutions, truncations, and extensions. Most single‐nucleotide substitutions, particularly within an mfold‐predicted stem, suppress binding, whereas those within a predicted loop have a minimal effect. The 5′‐end of the aptamer plays a key role in VEGF recognition, as a single‐nucleotide truncation abolished VEGF binding. Conversely, an 11‐fold increase in the association rate (and affinity) is observed with a single cytosine nucleotide extension, due to pairing of the 3′‐GGG with 5′‐CCC in the extended aptamer. Our approach effectively maps the secondary structural elements in the free aptamer, which present the unpaired interface for high affinity VEGF recognition. These data demonstrate that a directed binding analysis can be used in concert with library screening to characterize and improve aptamer/ligand recognition. © 2008 Wiley Periodicals, Inc. Biopolymers 91: 145–156, 2009. This article was originally published online as an accepted preprint. The “Published Online” date corresponds to the preprint version. You can request a copy of the preprint by emailing the Biopolymers editorial office at biopolymers@wiley.com     

2E8 Binds to the High Affinity I-domain in a Metal Ion-dependent Manner: A SECOND GENERATION MONOCLONAL ANTIBODY SELECTIVELY TARGETING ACTIVATED LFA-1*

The activation of leukocyte function-associated antigen-1 (LFA-1) plays a critical role in regulating immune responses. The metal ion-dependent adhesion site on the I-domain of LFA-1 α_L subunit is the key recognition site for ligand binding. Upon activation, conformation changes in the I-domain can lead LFA-1 from the low affinity state to the high affinity (HA) state. Using the purified HA I-domain locked by disulfide bonds for immunization, we developed an mAb, 2E8, that specifically binds to cells expressing the HA LFA-1. The surface plasmon resonance analysis has shown that 2E8 only binds to the HA I-domain and that the dissociation constant (K_D) for HA I-domain is 197 nm. The binding of 2E8 to the HA I-domain is metal ion-dependent, and the affinity decreased as Mn²⁺ was replaced sequentially by Mg²⁺ and Ca²⁺. Surface plasmon resonance analysis demonstrates that 2E8 inhibits the interaction of HA I-domain and ICAM-1. Furthermore, we found that 2E8 can detect activated LFA-1 on both JY and Jurkat cells using flow cytometry and parallel plate adhesion assay. In addition, 2E8 inhibits JY cell adhesion to human umbilical vein endothelial cells and homotypic aggregation. 2E8 treatment reduces the proliferation of both human CD4⁺ and CD8⁺ T cells upon OKT3 stimulation without the impairment of their cytolytic function. Taken together, these data demonstrate that 2E8 is specific for the high affinity form of LFA-1 and that 2E8 inhibits LFA-1/ICAM-1 interactions. As a novel activation-specific monoclonal antibody, 2E8 is a potentially useful reagent for blocking high affinity LFA-1 and modulating T cell activation in research and therapeutics.     

Cells as irreducible wholes: the failure of mechanism and the possibility of an organicist revival

According to vitalism, living organisms differ from machines and all other inanimate objects by being endowed with an indwelling immaterial directive agency, ‘vital force,’ or entelechy. While support for vitalism fell away in the late nineteenth century many biologists in the early twentieth century embraced a non vitalist philosophy variously termed organicism/holism/emergentism which aimed at replacing the actions of an immaterial spirit with what was seen as an equivalent but perfectly natural agency—the emergent autonomous activity of the whole organism. Organicists hold that organisms unlike machines are ‘more than the sum of their parts’ and predict that the vital properties of living things can never be explained in terms of mechanical analogies and that the reductionist agenda is doomed to failure. Here we review the current status of the mechanist and organicist conceptions of life particularly as they apply to the cell. We argue that despite the advances in biological knowledge over the past six decades since the molecular biological revolution, especially in the fields of genetics and cell biology the unique properties of living cells have still not been simulated in mechanical systems nor yielded to reductionist—analytical explanations. And we conclude that despite the dominance of the mechanistic–reductionist paradigm through most of the past century the possibility of a twentyfirst century organicist revival cannot be easily discounted.     

Discovery of 2-(α-methylbenzylamino) pyrazines as potent Type II inhibitors of FMS

A series of 2-(α-methylbenzylamino) pyrazines have shown to be potent inhibitors of the FMS tyrosine receptor kinase. Details of SAR studies, modeling and synthesis of compounds within this series are reported.     

A mechanism for antibody-mediated outside-in activation of LFA-1

MEM83 is an inserted domain (I-domain)-specific antibody that up-regulates the interaction of LFA-1 with ICAM-1 through an outside-in activation mechanism. We demonstrate here that there is no change in the affinity of the MEM83 antibody for the I-domain in either its low (wild-type) or high affinity form and that MEM83 does not enhance the binding of the wild-type I-domain to ICAM-1. Furthermore, we show that the antibody acts as an activating agent to induce LFA-1/ICAM-1-dependent homotypic cell aggregation only as an IgG, but not as a Fab fragment. On the basis of these data, we propose an avidity-based mechanism that requires no direct activation of the LFA-1 I-domain by the binding of the antibody; rather, activation is enhanced when there is an interaction with both arms of the IgG. A molecular model of the antibody interaction with LFA-1 illustrates the symmetry and accessibility of the two MEM83 epitopes across the LFA-1/ICAM-1 heterotetramer. We hypothesize that MEM83 stabilizes adjacent LFA-1 molecules in their active form by the free energy that is gained from the binding of the I-domains to each arm of the IgG. This leads to stabilization of the open state of the integrin and outside-in signaling. Our model supports a mechanism in which both affinity and avidity regulation are required in the activation of LFA-1.     

Fluorescence-based soft-sensor for monitoring beta-lactoglobulin and alpha-lactalbumin solubility during thermal aggregation

A soft-sensor for monitoring solubility of native-like alpha-lactalbumin (alpha-LA) and beta-lactoglobulin (beta-LG) and their aggregation behavior following heat treatment of mixtures under different treatment conditions was developed using fluorescence spectroscopy data regressed with a multivariate Partial Least Squares (PLS) regression algorithm. PLS regression was used to correlate the concentrations of alpha-LA and beta-LG to the fluorescence spectra obtained for their mixtures. Data for the calibration and validation of the soft sensor was derived from fluorescence spectra. The process of thermal induced aggregation of beta-LG and alpha-LA protein in mixtures, which involves the disappearance of native-like proteins, was studied under various treatment conditions including different temperatures, pH, total initial protein concentration and proportions of alpha-LA and beta-LG. It was demonstrated that the multivariate regression models used could effectively deconvolute multi-wavelength fluorescence spectra collected under a variety of process conditions and provide a fairly accurate quantification of respective native-like proteins despite the significant overlapping between their emission profiles. It was also demonstrated that a PLS model can be used as a black-box prediction tool for estimating protein aggregation when combined with simple mass balances.     

Are there valid proxy measures of clinical behaviour? a systematic review

Background

Accurate measures of health professionals' clinical practice are critically important to guide health policy decisions, as well as for professional self-evaluation and for research-based investigation of clinical practice and process of care. It is often not feasible or ethical to measure behaviour through direct observation, and rigorous behavioural measures are difficult and costly to use. The aim of this review was to identify the current evidence relating to the relationships between proxy measures and direct measures of clinical behaviour. In particular, the accuracy of medical record review, clinician self-reported and patient-reported behaviour was assessed relative to directly observed behaviour.

Methods

We searched: PsycINFO; MEDLINE; EMBASE; CINAHL; Cochrane Central Register of Controlled Trials; science/social science citation index; Current contents (social & behavioural med/clinical med); ISI conference proceedings; and Index to Theses. Inclusion criteria: empirical, quantitative studies; and examining clinical behaviours. An independent, direct measure of behaviour (by standardised patient, other trained observer or by video/audio recording) was considered the 'gold standard' for comparison. Proxy measures of behaviour included: retrospective self-report; patient-report; or chart-review. All titles, abstracts, and full text articles retrieved by electronic searching were screened for inclusion and abstracted independently by two reviewers. Disagreements were resolved by discussion with a third reviewer where necessary.

Results

Fifteen reports originating from 11 studies met the inclusion criteria. The method of direct measurement was by standardised patient in six reports, trained observer in three reports, and audio/video recording in six reports. Multiple proxy measures of behaviour were compared in five of 15 reports. Only four of 15 reports used appropriate statistical methods to compare measures. Some direct measures failed to meet our validity criteria. The accuracy of patient report and chart review as proxy measures varied considerably across a wide range of clinical actions. The evidence for clinician self-report was inconclusive.

Conclusion

Valid measures of clinical behaviour are of fundamental importance to accurately identify gaps in care delivery, improve quality of care, and ultimately to improve patient care. However, the evidence base for three commonly used proxy measures of clinicians' behaviour is very limited. Further research is needed to better establish the methods of development, application, and analysis for a range of both direct and proxy measures of behaviour.