Inhibition of neuronal apoptosis by docosahexaenoic acid (22:6n-3). Role of phosphatidylserine in antiapoptotic effect

Enrichment of Neuro 2A cells with docosahexaenoic acid (22:6n-3) decreased apoptotic cell death induced by serum starvation as evidenced by the reduced DNA fragmentation and caspase-3 activity. The protective effect of 22:6n-3 became evident only after at least 24 h of enrichment before serum starvation and was potentiated as a function of the enrichment period. During enrichment 22:6n-3 incorporated into phosphatidylserine (PS) steadily, resulting in a significant increase in the total PS content. Similar treatment with oleic acid (18:1n-9) neither altered PS content nor resulted in protective effect. Hindering PS accumulation by enriching cells in a serine-free medium diminished the protective effect of 22:6n-3. Membrane translocation of Raf-1 was significantly enhanced by 22:6n-3 enrichment in Neuro 2A cells. Consistently, in vitro biomolecular interaction between PS/phosphatidylethanolamine /phosphatidylcholine liposomes, and Raf-1 increased in a PS concentration-dependent manner. Collectively, enrichment of neuronal cells with 22:6n-3 increases the PS content and Raf-1 translocation, down-regulates caspase-3 activity, and prevents apoptotic cell death. Both the antiapoptotic effect of 22:6n-3 and Raf-1 translocation are sensitive to 22:6n-3 enrichment-induced PS accumulation, strongly suggesting that the protective effect of 22:6n-3 may be mediated at least in part through the promoted accumulation of PS in neuronal membranes.     

Degradation of cyclin A does not require its phosphorylation by CDC2 and cyclin-dependent kinase 2

Many cyclins are degraded by the ubiquitination/proteasome pathways involving the anaphase-promoting complex and SCF complexes. These degradations are frequently dependent on phosphorylation by cyclin-dependent kinases (CDKs), providing a self-limiting mechanism for CDK activity. Here we present evidence from in vitro and in vivo assay systems that the degradation of human cyclin A can be inhibited by kinase-inactive mutants of CDK2 and CDC2. One obvious interpretation of these results is that like other cyclins, CDK-dependent phosphorylation of the cyclin A may be involved in cyclin A degradation. Our data indicated that CDK2 can phosphorylate cyclin A on Ser-154. Site-directed mutagenesis of Ser-154 abolished the phosphorylation by recombinant CDK2 in vitro and the majority of cyclin A phosphorylation in the cell. Activation of CDK2 and binding to SKP2 or p27(KIP1) were not affected by the phosphorylation of Ser-154. Surprising, in marked contrast to cyclin E, where phosphorylation of Thr-380 by CDK2 is required for proteolysis, degradation of cyclin A was not affected by Ser-154 phosphorylation. It is likely that the stabilization of cyclin A by the kinase-inactive CDKs was mainly due to a cell cycle effect. These data suggest an important difference between the regulation of cyclin A and cyclin E.     

Bop1 is a mouse WD40 repeat nucleolar protein involved in 28S and 5. 8S RRNA processing and 60S ribosome biogenesis

We have identified and characterized a novel mouse protein, Bop1, which contains WD40 repeats and is highly conserved through evolution. bop1 is ubiquitously expressed in all mouse tissues examined and is upregulated during mid-G(1) in serum-stimulated fibroblasts. Immunofluorescence analysis shows that Bop1 is localized predominantly to the nucleolus. In sucrose density gradients, Bop1 from nuclear extracts cosediments with the 50S-80S ribonucleoprotein particles that contain the 32S rRNA precursor. RNase A treatment disrupts these particles and releases Bop1 into a low-molecular-weight fraction. A mutant form of Bop1, Bop1Delta, which lacks 231 amino acids in the N- terminus, is colocalized with wild-type Bop1 in the nucleolus and in ribonucleoprotein complexes. Expression of Bop1Delta leads to cell growth arrest in the G(1) phase and results in a specific inhibition of the synthesis of the 28S and 5.8S rRNAs without affecting 18S rRNA formation. Pulse-chase analyses show that Bop1Delta expression results in a partial inhibition in the conversion of the 36S to the 32S pre-rRNA and a complete inhibition of the processing of the 32S pre-rRNA to form the mature 28S and 5.8S rRNAs. Concomitant with these defects in rRNA processing, expression of Bop1Delta in mouse cells leads to a deficit in the cytosolic 60S ribosomal subunits. These studies thus identify Bop1 as a novel, nonribosomal mammalian protein that plays a key role in the formation of the mature 28S and 5.8S rRNAs and in the biogenesis of the 60S ribosomal subunit.     

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.     

The broad-spectrum antiviral ribonucleoside ribavirin is an RNA virus mutagen

The ribonucleoside analog ribavirin (1-beta-D-ribofuranosyl-1,2, 4-triazole-3-carboxamide) shows antiviral activity against a variety of RNA viruses and is used in combination with interferon-alpha to treat hepatitis C virus infection. Here we show in vitro use of ribavirin triphosphate by a model viral RNA polymerase, poliovirus 3Dpol. Ribavirin incorporation is mutagenic, as it templates incorporation of cytidine and uridine with equal efficiency. Ribavirin reduces infectious poliovirus production to as little as 0. 00001% in cell culture. The antiviral activity of ribavirin correlates directly with its mutagenic activity. These data indicate that ribavirin forces the virus into 'error catastrophe'. Thus, mutagenic ribonucleosides may represent an important class of anti-RNA virus agents.     

Checkpoint-dependent activation of mutagenic repair in Saccharomyces cerevisiae pol3-01 mutants

The Saccharomyces cerevisiae DNA polymerase delta proofreading exonuclease-defective mutation pol3-01 is known to cause high rates of accumulating mutations. The pol3-01 mutant was found to have abnormal cell cycle progression due to activation of the S phase checkpoint. Inactivation of the S phase checkpoint suppressed both the pol3-01 cell cycle progression defect and mutator phenotype, indicating that the pol3-01 mutator phenotype was dependent on the S phase damage checkpoint pathway. Epistasis analysis suggested that a portion of the pol3-01 mutator phenotype involves members of the RAD6 epistasis group that function in both error-free and error-prone repair. These results indicate that activation of a checkpoint in response to certain types of replicative defects can result in the accumulation of mutations.     

Virus-specific cofactor requirement and chimeric hepatitis C virus/GB virus B nonstructural protein 3

GB virus B (GBV-B) is closely related to hepatitis C virus (HCV) and causes acute hepatitis in tamarins (Saguinus species), making it an attractive surrogate virus for in vivo testing of anti-HCV inhibitors in a small monkey model. It has been reported that the nonstructural protein 3 (NS3) serine protease of GBV-B shares similar substrate specificity with its counterpart in HCV. Authentic proteolytic processing of the HCV polyprotein junctions (NS4A/4B, NS4B/5A, and NS5A/5B) can be accomplished by the GBV-B NS3 protease in an HCV NS4A cofactor-independent fashion. We further characterized the protease activity of a full-length GBV-B NS3 protein and its cofactor requirement using in vitro-translated GBV-B substrates. Cleavages at the NS4A/4B and NS5A/5B junctions were readily detectable only in the presence of a cofactor peptide derived from the central region of GBV-B NS4A. Interestingly, the GBV-B substrates could also be cleaved by the HCV NS3 protease in an HCV NS4A cofactor-dependent manner, supporting the notion that HCV and GBV-B share similar NS3 protease specificity while retaining a virus-specific cofactor requirement. This finding of a strict virus-specific cofactor requirement is consistent with the lack of sequence homology in the NS4A cofactor regions of HCV and GBV-B. The minimum cofactor region that supported GBV-B protease activity was mapped to a central region of GBV-B NS4A (between amino acids Phe22 and Val36) which overlapped with the cofactor region of HCV. Alanine substitution analysis demonstrated that two amino acids, Val27 and Trp31, were essential for the cofactor activity, a finding reminiscent of the two critical residues in the HCV NS4A cofactor, Ile25 and Ile29. A model for the GBV-B NS3 protease domain and NS4A cofactor complex revealed that GBV-B might have developed a similar structural strategy in the activation and regulation of its NS3 protease activity. Finally, a chimeric HCV/GBV-B bifunctional NS3, consisting of an N-terminal HCV protease domain and a C-terminal GBV-B RNA helicase domain, was engineered. Both enzymatic activities were retained by the chimeric protein, which could lead to the development of a chimeric GBV-B virus that depends on HCV protease function.     

Hepatitis C virus internal ribosome entry site (IRES) stem loop IIId contains a phylogenetically conserved GGG triplet essential for translation and IRES folding

The hepatitis C virus (HCV) internal ribosome entry site (IRES) is a highly structured RNA element that directs cap-independent translation of the viral polyprotein. Morpholino antisense oligonucleotides directed towards stem loop IIId drastically reduced HCV IRES activity. Mutagenesis studies of this region showed that the GGG triplet (nucleotides 266 through 268) of the hexanucleotide apical loop of stem loop IIId is essential for IRES activity both in vitro and in vivo. Sequence comparison showed that apical loop nucleotides (UUGGGU) were absolutely conserved across HCV genotypes and the GGG triplet was strongly conserved among related Flavivirus and Pestivirus nontranslated regions. Chimeric IRES elements with IIId derived from GB virus B (GBV-B) in the context of the HCV IRES possess translational activity. Mutations within the IIId stem loop that abolish IRES activity also affect the RNA structure in RNase T(1)-probing studies, demonstrating the importance of correct RNA folding to IRES function.