Membrane-trafficking RabA4c involved in the effect of glycine betaine on recovery from chilling stress in Arabidopsis

Glycine betaine (GB) can confer tolerance to several types of stress at low concentrations, either after application to plants or in transgenics engineered to overproduce GB. Based on earlier studies on levels of GB in plants and evidence for effects on gene expression, we hypothesized that at least part of this effect could be ascribed to the activation of the expression of stress tolerance genes. Using a strategy based on high-throughput gene expression analysis with microarrays followed by confirmation with northern blots, we identified Arabidopsis genes upregulated in roots that reinforce intracellular processes protecting cells from oxidative damage and others that appear to be involved in reinforcing a scavenging system for reactive oxygen species (ROS) in cell walls. Upregulated genes in roots include those for the membrane-trafficking RabA4c, the root-specific NADPH-dependent ferric reductase (FRO2) localized to the plasma membrane, mitochondrial catalase 2 and the cell wall peroxidase ATP3a. Comparative studies with wild-type Arabidopsis and knockout mutants for the membrane-trafficking RabA4c gene demonstrated that the mutants respond only slightly to GB, if at all, compared with wild-type in relation to root growth recovery after chilling stress, demonstrating the role of RabA4c in relation to the GB effect. The results point toward links between oxidative stress, gene expression, membrane trafficking and scavenging of ROS such as superoxide and hydrogen peroxide in relation to GB effects on chilling tolerance in plants.     

Location of crosslinks in chemically stabilized horseradish peroxidase: implications for design of crosslinks.

The bifunctional compound, ethylene-glycol bis(N-hydroxysuccinimidylsuccinate) (EGNHS), stabilizes horseradish peroxidase C (HRP) by reaction with the enzyme's lysine residues. In this study we compare native and modified HRP by proteolytic fragmentation, peptide sequencing, and mass spectroscopy, and identify the sites of modification. Most significantly, EGNHS is shown to form a crosslink between Lys232 and Lys241 of HRP and modifies Lys174 without formation of a crosslink. These findings are in agreement with the lysine side-chain reactivities predicted from the surface accessibility of the amino groups, and the maximal span of 16 A of the EGNHS crosslinker.     

Sampling and filtration efficiency of two commonly used plankton nets. A comparative study of the Nansen net and the Unesco WP 2 net

The paper presents the results from a study in which two commonlyused plankton nets, the Nansen net and the WP 2 net, were compared.The study was performed at six stations in the Baltic Sea andthe samples were collected during seasons of both high and lowparticle abundance. The comparison included both qualitativeand quantitative filtration capacity of the nets under differentenvironmental conditions. Different mesh sizes were also tested.The results show that the Nansen net has an efficiency of 50–70%compared to the WP 2 net under favourable conditions. When conditionsare unfavourable, i.e. during periods of high particle abundanceor during long hauls, the efficiency may be as low as 25–30%.The mesh size of the nets proved to be of decisive importancefor the qualitative composition of the samples. Most of thesmaller size fractions such as rotifers, copepod nauplii andyoung copepodites passed through the 160 and 200 µm meshes.The 90 µm nets sampled these fractions well but with thedrawback of retaining vast amounts of phytoplankton at certaintimes of the year.     

Large Alterations in Ganglioside and Neutral Glycosphingolipid Patterns in Brains from Cases with Infantile Neuronal Ceroid Lipofuscinosis/Polyunsaturated Fatty Acid Lipidosis

Lipid composition was studied on cerebral tissue from nine children who had died of a progressive encephalopathy called the infantile form of neuronal ceroid lipofuscinosis (INCL) or polyunsaturated fatty acid lipidosis (PFAL). In the terminal stage of the disease, the concentrations of all lipid classes were found to be significantly reduced in the cerebral and cerebellar cortex and white matter. The concentration of gangliosides of the cerebral cortex was 15% and that of cerebrosides (galactosylceramide) in white matter 0.2-5% of the normal values for the children's ages. The reduction of gangliosides mainly affected those of the gangliotetraose series, particularly GD1a. The fatty acids of the linolenic acid series were strongly reduced in ethanolamine and serine phosphoglycerides. A very large increase up to 100-fold of oligoglycosphingolipids of the globo series and two fucose-containing lipids of the neolacto series was found in the forebrain of the three advanced cases examined. The brain tissue also contained very high concentrations of mono-, di-, and trisialogangliosides of the lacto and neolacto series, gangliosides with type 1 chain dominating. The structures of the gangliosides were tentatively identified by gas chromatography-mass spectrometry and monoclonal antibodies with carefully determined epitope specificity. The gangliosides and neutral glycosphingolipids had very similar fatty acid composition, consisting of about 40% stearic acid and 40% C24-acids.     

Stressful life events preceding the acute onset of schizophrenia: A cross-national study from the World Health Organization

This study reports on the findings from a WHO sponsored cross-national investigation of life events and schizophrenia. Data are presented from a series of 386 acutely ill schizophrenic patients selected from nine field research centers located in developing and developed countries (Aarhus, Denmark; Agra, India; Cali, Colombia; Chandigarh, India; Honolulu, USA; Ibadan, Nigeria; Nagasaki, Japan; Prague, Czechoslovakia; Rochester, USA). On a methodological level, the study demonstrates that life event methodologies originating in the developed countries can be adapted for international studies and may be used to collect reasonably reliable and comparable cross-cultural data on psychosocial factors affecting the course of schizophrenic disorders. Substantive findings replicate the results of prior studies which conclude that socioenvironmental stressors may precipitate schizophrenic attacks and such events tend to cluster in the two to three week period immediately preceding illness onset.The paper was prepared by these authors on behalf of the collaborating investigators listed on page 196.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Effect of dietary boron on mineral, estrogen, and testosterone metabolism in postmenopausal women

A study was done to examine the effects of aluminum, magnesium, and boron on major mineral metabolism in postmenopausal women. This communication describes some of the effects of dietary boron on 12 women between the ages of 48 and 82 housed in a metabolic unit. A boron supplement of 3 mg/day markedly affected several indices of mineral metabolism of seven women consuming a low-magnesium diet and five women consuming a diet adequate in magnesium; the women had consumed a conventional diet supplying about 0.25 mg boron/day for 119 days. Boron supplementation markedly reduced the urinary excretion of calcium and magnesium; the depression seemed more marked when dietary magnesium was low. Boron supplementation depressed the urinary excretion of phosphorus by the low-magnesium, but not by the adequate-magnesium, women. Boron supplementation markedly elevated the serum concentrations of 17 beta-estradiol and testosterone; the elevation seemed more marked when dietary magnesium was low. Neither high dietary aluminum (1000 mg/day) nor an interaction between boron and aluminum affected the variables presented. The findings suggest that supplementation of a low-boron diet with an amount of boron commonly found in diets high in fruits and vegetables induces changes in postmenopausal women consistent with the prevention of calcium loss and bone demineralization.     

Simultaneous demonstration of two antigens in ultrathin cryosections by a novel application of an immunogold staining method using primary antibodies from the same species

A recently developed immunocytochemical double-staining method for ultrathin Epon and Lowicryl K4M sections has been adopted for use on ultrathin cryosections. The essential features of the method include: staining for the first antigen by the indirect method using sufficient concentrations of second antibodies conjugated to colloidal gold particles to saturate available epitopes on the primary antibodies; supporting the cryosections by methyl cellulose followed by paraformaldehyde vapour treatment (30-60 min at 80 degrees C); removal of the methyl cellulose followed by staining for the second antigen using primary antiserum from the same species and another size class of colloidal gold particles conjugated to second antibodies. Contaminating staining does not occur if the paraformaldehyde vapour treatment exceeds 30 min, as this treatment destroys the combining sites on the second antibodies applied in the first staining cycle. Successful double-staining was documented using primary rabbit antibodies to growth hormone and corticotropin and anti-rabbit IgG conjugated to 5 and 15 nm colloidal gold particles. Following double-staining, the ultrathin cryosections may be silver-enhanced to improve detectability of the markers at low magnification.