An effect of tricaine methanesulfonate on the electroretinogram of Taricha granulosa.

MS-222 is an anesthetic that is widely used for cold-blooded animals. The present study uses contact circum-corneal electrodes and conventional recording equipment to determine the effect of this anesthetic on the electroretinogram (ERG) of the rough-skinned newt ($\text{Taricha granulosa}$). When applied prior to retinal bleach, MS-222 retarded the rate of subsequent dark adaptation. This retardation was evidenced by a decreased sensitivity to light during the adaptation process, and by a higher threshold for induction of an ERG response after bleach.     

The role of glucagon in the regulation of blood glucose: Model studies

Mathematical models afford a procedure of unifying concepts and hypotheses by expressing quantitative relationships between observables. The model presented indicates the roles of both insulin and glucagon as regulators of blood glucose, albeit in different ranges of the blood glucose concentrations. Insulin secretion is induced during hyperglycemia, while glucagon secretion results during hypoglycemia. These are demonstrated by simulations of a mathematical model conformed to data from the oral glucose tolerance test and the insulin infusion test in normal control subjects and stable and unstable diabetic patients. The model studies suggest the parameters could prove of value in quantifying the diabetic condition by indicating the degree of instability. Presented at the Society for Mathematical Biology Meeting, University of Pennsylvania, Philadelphia, August 19–21, 1976.     

Cellulose acetate electrophoresis of protein kinases: Detection of the active forms using various substrates

Electrophoresis on cellulose acetate strips was used to analyze protein kinases from normal rat liver. In addition to already well-characterized cAMP-dependent protein kinases type I and II and cAMP-independent casein kinases I and II, this method enabled the detection of several supplementary bands corresponding to kinases which were investigated according to their substrate specificity, activation by cAMP, and inhibition by the specific inhibitor of the catalytic subunit of cAMP-dependent protein kinases or by heparin. Using this rapid, sensitive, and resolutive electrophoretic method, different isozyme patterns could be obtained starting from minute amounts of different types of biological material.     

The importance of FeEDTA for reversibility of phosphate-induced chlorosis in maize (Zea mays L.)

Chlorosis induced with a supraoptimum dose of phosphorus in nutrient solution (69 mg P l^-1) was reverted by spraying of leaves of chlorotio maize plants (Zea mays L.) with FeEDTA. Biomass formation, chlorophyll and iron content were decreased in the above-ground parts of plants grown under chlorosis-inducing conditions. Spraying always decreased content of inorganic phosphorus (P_i/Fe ratio was significantly changed), increased chlorophyll content in old plants and stimulated dry mass formation at supraoptimum phosphorus doses. FeEDTA application improved phosphate utilization (portion of phosphate in organic bonds was increased). This may be the basis of chlorosis-reverting effect of FeEDTA.     

Brain endocast asymmetry in pongids and hominids: Some preliminary findings on the paleontology of cerebral dominance

Observations on petalial asymmetry for 190 hominoid endocasts are reported, and their statistical differences assessed. While all taxa of hominoids show asymmetries to various degrees, the patterns or combinations of petalial asymmetries are very different, with fossil hominids and modern Homo sapiens showing an identical pattern of left-occipital, right-frontal petalias, which contrasts with those found normally in pongids. Of the pongids, Gorilla shows the greater degree of asymmetry in left-occipital petalias. Only modern Homo and hominids (Australopithecus, Homo erectus, Neandertals) show a distinct left-occipital, right-frontal petalial pattern. Analysis by x² statistics shows the differences to be highly significant. Due to small sample size and incompleteness of endocasts, small-brained hominids, i.e., Australopithecus, are problematical. To the degree that gross petalial patterns are correlated with cognitive task specialization, we speculate that human cognitive patterns evolved early in hominid evolution and were related to selection pressures operating on both symbolic and spatiovisual integration, and that these faculties are corroborated in the archaeological record.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Biological characterization of Trichinella isolates from various host species and geographical regions.

Forty isolates of Trichinella collected from 5 continents were compared for 7 biological characters: newborn larvae produced per female worm cultured in vitro at the seventh, eighth, and ninth day postinfection, host muscle nurse cell development time, reproductive capacity index in rats and chickens, and resistance of muscle larvae to freezing. The isolates also were compared by analyses of an environmental character of the location from which they were isolated: the isotherms for January and July. By factorial analysis of correspondence of the biological and environmental data, the 40 isolates were grouped into 8 gene pools (T1-T8). The environmental temperature-related distribution was more evident for the sylvatic isolates (T2, T3, T5, T6, T7, T8), than for T1, which was isolated from domestic pigs, and for T4, a bird-adapted, nonencapsulating genetic type. The 8 biological groups correlated closely with the 8 gene pools previously identified on the basis of allozyme analysis. These results support the concept that the genus Trichinella is composed of at least 5 distinct gene pools or sibling species: Trichinella spiralis sensu stricto (T1), Trichinella nativa (T2), Trichinella sp. (T3), Trichinella pseudospiralis (T4), and Trichinella nelsoni (T7), and 3 other groups of uncertain taxonomic status (i.e., T5, T6, and T8).     

1H nuclear magnetic resonance investigation of cobalt(II) substituted carbonic anhydrase.

The structure of ClO4 and NO3 adducts of cobalt(II) substituted bovine carbonic anhydrase have been investigated through 1D NOE and 2D 1H nuclear magnetic resonance (NMR) spectroscopy. For the first time two-dimensional NMR techniques are applied to paramagnetic metalloproteins other than iron-containing proteins. Several active site signals have been assigned to specific protons on the grounds of their scalar and dipolar connectivities and T1 values. The experimental dipolar shifts for the protons belonging to noncoordinated residues have allowed the identification of a plausible orientation of the magnetic susceptibility tensor around the cobalt ion as well as of the magnitude and the anisotropy of the principal susceptibility values. In turn, a few more signals have been tentatively assigned on the grounds of their predicted dipolar shifts. The two inhibitor derivatives have a very similar orientation but a different magnitude of the chi tensor, and the protein structure around the active site is highly maintained. The results encourage a more extensive use of the two-dimensional techniques for obtaining selective structural information on the active site of metalloenzymes. With this information at hand, comparisons within homologous series of adducts with various inhibitors and/or mutants of the same enzyme of known structure should be possible using limited sets of NMR data.     

Time-resolved fluorescence study of human recombinant interferon alpha 2. Association state of the protein, spatial proximity of the two tryptophan residues.

Human recombinant interferon alpha 2 belongs a to family of proteins active against a wide range of viruses. It contains two tryptophan residues located at positions 77 and 141 in the peptide sequence. The fluorescence emission spectrum of these tryptophan residues displays a maximum at 335 nm. The fluorescence intensity decay is described by one broad excited-state-lifetime population centered around a value of 1.7 ns (full width at half maximum, 1.5 ns). These observations suggest that in the native protein, both tryptophan residues emit from similar environments, not directly exposed to the surrounding solvent. The anisotropy decay is essentially biexponential. The correlation-time value characterizing the Brownian rotation of the protein varies linearly with the viscosity/temperature ratio. The calculated hydrodynamic volumes are compatible with the existence of a dimer and a tetramer, at pH 5.5 and 9.4, respectively. Addition of urea at pH 5.5 disrupts the dimer and modifies to some extent the excited-state-lifetime distribution which becomes more heterogeneous. Disulfide-bond reduction also dissociates the dimer and leads to a highly heterogeneous fluorescence-intensity decay with four excited-state-lifetime populations. An opening of the local structure in the Trp region of the protein is likely to occur in these conditions. The fast-anisotropy-decay components can be due to either fast rotation or energy transfer between the indoles. Close proximity of the two Trp residues (less than 1 nm) is suggested from steady-state and time-resolved fluorescence-anisotropy measurements in vitrified medium [95% (by mass) glycerol at -38 degrees C]. This suggestion is in agreement with the recently published three-dimensional structure of the homologous protein murine interferon beta [Senda, T., Shimazu, T., Matsuda, S. Kawano, G., Shimizu, H., Nakamura, K. T. & Mitsui, Y. (1992) EMBO J. 11, 3193-3201].