Comparative assessment of inductive effects of Azospirillum lectins with different antigenic properties on the signal systems of wheat seedling roots

The lectins of associative nitrogen-fixing bacteria Azospirillum brasilense Sp7 and its mutant A. brasilense Sp7.2.3 were shown to have different effects on the components of the wheat seedling root signal system, namely to regulate the levels of cAMP, nitric oxide, diacylglycerol, and salicylic acid, as well as to induce the activities of superoxide dismutase and lipoxygenase. Our results make it possible to consider azospirilla lectins as inducers of the signal systems in wheat seedling roots, since they cause development of several flows of primary signals. These data are of general biological importance, since lectins are present in all living organisms and most of the functions of lectins remain insufficiently understood.     

About possible functional interaction between serotonin and neuropeptides in control processes of embryogenesis (Experiments on embryos ofTritonia diomedea)

Ritanserin and inmecarb hydrochloride, antagonists of serotonin, act cytostatically and teratogenically on early embryos ofTritonia diomedea, a nudibranch mollusk. On the basis of a pharmacological analysis and the type of developmental abnormalities observed, this action appears to be due to disturbances in the functional activity of endogenous serotonin and is associated with damage to the cytoskeleton. The effects of ritanserin and inmecarb are prevented or attenuated by lipophilic serotonin analogs (serotoninamides of polyenoic fatty acids), as well as by polypeptides isolated from neurons Pd5 and Pd6 of the pedal ganglia of the adultTritonia. In late embryos (stage of veligers), serotonin and to a lesser extent its lipophilic analogs strongly increase embryonic motility. This effect of serotonin is potentiated by some neuropeptides and inhibited by others. These results provide evidence for functional interaction between serotonin and neuropeptides in the control processes of embryogenesis.     

Lipoproteins from normolipidemic and dyslipidemic subjects modify the thromboxane A2 generation by platelets in clotting human blood

The study was performed to investigate the influence of lipoproteins (LP) on the thromboxane (TX) A₂ formation capacity of platelets in clotting whole blood in vitro. The different lipoprotein fractions VLDL, LDL, HDL₂ and HDL₃ were isolated from blood of normo- or dyslipidemic volunteers by ultracentrifugation. These lipoproteins were incubated in blood with different levels of serum total cholesterol (TC) taken from normolipidemics (TC < 200 mg/dl), moderate hypercholesterolemics (TC: 200–250 mg/dl) or subjects with high cholesterol level (TC > 250 mg/dl), respectively. The amount of serum TXA₂ formed within 60 min at 37°C was measured by enzyme immunoassay. The results obtained show that the efficacy of separate LP fractions to influence the TXA₂ production depends not only on the type of LP fraction but also on the source of plasma used for isolation of LP and on the cholesterol level in the blood for incubation: LDL taken from normolipidemics or moderate hyperlipidemics inhibited the TXA₂ formation in blood from normolipidemics (P < 0.02, respectively), but enhanced it in blood from persons with moderate hypercholesterolemia (P < 0.05). LDL from hyperlipidemics enhanced TXA₂ production in blood from hyperlipidemics (P < 0.05). The HDL₂ fractions inhibited the TXA₂ formation in blood from normo- and hypercholesterolemics (P < 0.02, resp.), but there was no effect of HDL₂ in clotting blood from persons with moderate hypercholesterolemia. All HDL₃ fractions tested inhibited the TXA₂ formation in all types of blood used for clotting (P < 0.02, resp.), probably due to their great cholesterol accepting capacity.     

Functioning of Enzyme Systems of Digestive and Non-Digestive Organs in Adult Rats Depends on Quality of Nutrition in Early Ontogenesis

It is revealed that restriction of protein in nutrition of rat pups in early ontogenesis, at the period of transition from the mixed to the definitive nutrition, produces change of structural parameters and functioning of digestive enzymes in various parts of small intestine (duodenum, jejunum, and ileum) and in large intestine as well as of these hydrolases in liver and kidney in adult life. The disturbance of quality of nutrition in early ontogenesis seems to affect negatively digestive functions of small intestine and trophic-barrier function of large intestine, liver, and kidney, which can promote development of diseases not only of the gastrointestinal tract, but also of other organs.     

Synthesis and functional activity of translation initiation regions in mRNA. 20-base polyribonucleotides from the replicase gene of phage MS2 and fr

Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.     

The Effect of Stabilizing Mutations in the Central Part of α-Chain of Tropomyosin on the Bending Stiffness of Reconstructed Thin Filaments that Contain Its αβ-Heterodimers

We studied the effect of the replacement of two highly conserved noncanonical residues in the α-chain of tropomyosin, that is, Asp137 and Gly126, with the canonical residues, Leu and Arg, on the mechanical properties of reconstructed thin filaments that contain αβ-heterodimers of tropomyosin. For this purpose, the reconstructed thin filaments that contain fibrillar actin, tropomyosin, and troponin were stretched with an optical trap. The resulting strain–force diagrams were analyzed using a mathematical model proposed previously in order to estimate the bending stiffness. It was shown that the thin filaments that contain αβ-heterodimers of tropomyosin with α-chains of the pseudo-wild type, i.e., that contain the C190A substitution, have approximately the same bending stiffness as the filament with αα-homodimers of tropomyosin. The stabilizing substitution D137L in the α-chain of tropomyosin did not cause a statistically significant change in the bending stiffness of the filaments that contain αβ-heterodimers of tropomyosin, whereas the G126R and G126R/D137L substitutions led to a moderate increase in this stiffness. This increase in stiffness was, however, much less pronounced than that for the filaments that contain αα-homodimers of tropomyosin with these substitutions in both α-chains. The relationship between the results obtained in this study and the previously published data on the effects of these stabilizing substitutions in the α-chain of tropomyosin on the structural and functional properties of thin filaments with αβ-heterodimers of tropomyosin is discussed.     

Novel nucleosomal particles containing core histones and linker DNA but no histone H1

Eukaryotic chromosomal DNA is assembled into regularly spaced nucleosomes, which play a central role in gene regulation by determining accessibility of control regions. The nucleosome contains ∼147 bp of DNA wrapped ∼1.7 times around a central core histone octamer. The linker histone, H1, binds both to the nucleosome, sealing the DNA coils, and to the linker DNA between nucleosomes, directing chromatin folding. Micrococcal nuclease (MNase) digests the linker to yield the chromatosome, containing H1 and ∼160 bp, and then converts it to a core particle, containing ∼147 bp and no H1. Sequencing of nucleosomal DNA obtained after MNase digestion (MNase-seq) generates genome-wide nucleosome maps that are important for understanding gene regulation. We present an improved MNase-seq method involving simultaneous digestion with exonuclease III, which removes linker DNA. Remarkably, we discovered two novel intermediate particles containing 154 or 161 bp, corresponding to 7 bp protruding from one or both sides of the nucleosome core. These particles are detected in yeast lacking H1 and in H1-depleted mouse chromatin. They can be reconstituted in vitro using purified core histones and DNA. We propose that these ‘proto-chromatosomes’ are fundamental chromatin subunits, which include the H1 binding site and influence nucleosome spacing independently of H1.