Intracellular regulation of cell signaling cascades: how location makes a difference

Organelles such as endosomes and the Golgi apparatus play a critical role in regulating signal transmission to the nucleus. Recent experiments have shown that appropriate positioning of these organelles within the intracellular space is critical for effective signal regulation. To understand the mechanism behind this observation, we consider a reaction-diffusion model of an intracellular signaling cascade and investigate the effect on the signaling of intracellular regulation in the form of a small release of phosphorylated signaling protein, kinase, and/or phosphatase. Variational analysis is applied to characterize the most effective regions for the localization of this intracellular regulation. The results demonstrate that signals reaching the nucleus are most effectively regulated by localizing the release of phosphorylated substrate protein and kinase near the nucleus. Phosphatase release, on the other hand, is nearly equally effective throughout the intracellular space. The effectiveness of the intracellular regulation is affected strongly by the characteristics of signal propagation through the cascade. For signals that are amplified as they propagate through the cascade, reactions in the upstream levels of the cascade exhibit much larger sensitivities to regulation by release of phosphorylated substrate protein and kinase than downstream reactions. On the other hand, for signals that decay through the cascade, downstream reactions exhibit larger sensitivity than upstream reactions. For regulation by phosphatase release, all reactions within the cascade show large sensitivity for amplified signals but lose this sensitivity for decaying signals. We use the analysis to develop a simple model of endosome-mediated regulation of cell signaling. The results demonstrate that signal regulation by the modeled endosome is most effective when the endosome is positioned in the vicinity of the nucleus. The present findings may explain at least in part why endosomes in many cell types localize near the nucleus.     

Cyclic GMP-dependent and cyclic AMP-dependent protein kinases,protein kinase modulators and phosphodieterases in arteries and veins of dogs Distribution and effects of arteriovenous fistula and arterial occlusion

Possible involvement of cyclic GMP-dependent and cyclic AMP-dependent protein kinases, protein kinase modulators and cyclic nucleotide phosphodiesterases in functions of vascular tissues were investigated in the dog. All of the above activities, localized in the smooth muscle-rich inner layer of the blood vessels, were found to be higher in the arteries than in the veins. The peripheral arteries were disproportionately richer in cyclic GMP-dependent protein kinase (as indicated by high ratios of cyclic GMP-dependent to cyclic AMP-dependent protein kinase) than were the veins, with the exception of the pulmonary artery, an atypical arterial tissue exposed to low blood pressure. Interestingly, the protein kinase ratio for the aorta, an artery with no significant role in blood pressure regulation, was not higher than that for the vena cava. Creation of femoral arteriovenous fistulae in the dogs led to preferential reductions in the cyclic GMP-dependent enzyme activity both in the proximal and distal arteries, whereas it was elevated in the stressed vein distal to the anastomotic site. The cyclic GMP-dependent enzyme was preferentially reduced in the saphenous artery distal to occlusion. Changes in the cyclic GMP-dependent enzyme activity appeared to precede gross atrophy or hypertrophy of the vessels. It is suggested that the vascular cyclic GMP-dependent protein kinase may be closely related to peripheral resistance and its regulation.     

Quantitative EMG analysis to investigate synergistic coactivation of ankle and knee muscles during isokinetic ankle movement. Part 2: time frequency analysis.

Fundamental to intralimb coordination in the lower extremity, ankle-knee synergy induced by motor irradiation has long been employed to secure facilitation of paralyzed muscles. This study, a companion research subsequent to the time amplitude analysis of surface electromyography in part 1, was to investigate the recruitment strategy of irradiated muscles and prime movers during ankle isokinetic contraction at different contraction speeds (30, 60, 120 and 240 degrees/s) with time frequency analysis. The results indicated the recruitment strategies of the major irradiated muscles (ipsilateral rectus femoris/ipsilateral biceps femoris) and prime movers (anterior tibialis/gastrocnemius) were time-dependent and significantly different in terms of the instantaneous median frequency. In general, the prime movers for ankle isokinetic concentric contraction demonstrated a similar recruitment strategy, irrespective of different contraction speeds. This finding is consistent with the idea of generalized motor programs that speed is one of the constraint parameters supplied to motor programs. Nevertheless, the recruitment strategies of the irradiated muscles were highly inconsistent, varying across trials at different contraction speeds, and were not relevant to those of the prime movers. In addition, the recruitment in the irradiated muscles seemly limited to motor units of low threshold, in spite of maximal voluntary contraction of the prime movers.     

Cleavage of territrems by alkaline hydrogen peroxide: Isolation and characterization of the aromatic moiety of territrems

The chemical reaction of cleavaging territrem B to give 3,4,5-trimethoxy benzoic acid by alkaline hydrogen peroxide was investigated. The method was applied for confirmation of the chemical structure of the aromatic moiety of territrem A, A’, B, and B’. The physicochemical properties of the aromatic cleavage product of territrem Aindicated the structure as 3,4-methylendioxy, 5-methoxy benzoic acid (or 4-methoxy, 6-carboxy, 1, 3-benzodioxole). The experiment also gave the evidences that territrem A and A’, on the other hand territrem B and B’ have the identical aromatic moieties on their structures.     

Glomerular filtration rate and blood pressure monitoring in awake baboons

Minimally invasive techniques were used to collect urine with an external catheter together with automated intermittent monitoring of arterial blood pressure in awake male baboons. Using endogenous creatinine, 24-hour creatinine clearances were measured for 2 to 3 consecutive days in four intact and in four uninephrectomized baboons. Despite large differences in urinary volume and sodium excretion, reproducibility of 24-hour creatinine clearances was within 15% in 15 of 19 studies obtained from 6 of 8 animals. Arterial blood pressure was monitored intermittently at 30 to 60 minute intervals over 24 hours with a Dinamap monitor and recorder. Mean blood pressure averaged 71 +/- 4.4 to 89 +/- 5.5 mm Hg in different animals. Blood pressure tended to be lower at night than during the day. In separate studies using 15 to 60 minute urine collection periods, inulin clearance was compared in awake and in anesthetized animals with endogenous or exogenous creatinine clearance measured simultaneously. The clearance of creatinine systematically exceeded the clearance of inulin, even in intact animals with a normal serum creatinine. The creatinine-to-inulin clearance ratio averaged 1.16 +/- 0.03 at a serum concentration of 0.7 to 0.8 mg/dl; 1.27 +/- 0.03 at a serum creatinine of 1.0 to 1.1 mg/dl and 1.56 +/- 0.04 at a serum creatinine greater than 10 mg/dl. All values exceed unity significantly (p less than 0.001). Thus, renal function, including inulin clearance, can be measured in awake baboons. Duplicate or triplicate 24-hour urine collections are needed to assess the reliability of creatinine excretion. However, creatinine clearance overestimates glomerular filtration rate, as it does in humans.     

Epstein-Barr virus nuclear antigen forms a complex that binds with high concentration dependence to a single DNA-binding site.

A bacterially synthesized 28-kilodalton carboxyl-terminal fragment (28K-EBNA of Epstein-Barr virus nuclear antigen shows highly concentration dependent binding to monomer, dimer, and trimer copies of synthetic DNA-binding site 5' GATCTAGGATAGCATATGCTACCCCGGGG 3' 3' ATCCTATCGTATACGATGGGGCCCCCTAG 5' in bacterial plasmids. The rate of the binding reaction is independent of the number of sites, but dependent upon the length of the DNA containing the sites. These data are consistent with 28K-EBNA locating its binding sites by a process of facilitated transfer or sliding along the DNA. The highly concentration dependent binding suggests that multiple 28K-EBNA monomer polypeptides form a complex before or during binding. Binding occurs equally well at 24 and 37 degrees C, but not at 0 degrees C. A 28K-EBNA complex bound to a single site has unoccupied binding sites capable of interacting with additional DNA molecules. Such interaction is confirmed by agarose gel electrophoresis of protein-DNA complexes which indicate that a 28K-EBNA complex forms bridges between two DNA molecules. A bridge between the two binding regions in the Epstein-Barr virus origin of plasmid replication (oriP) would form a loop structure which could be an important feature for the regulatory function of authentic Epstein-Barr virus nuclear antigen.     

Phorbol ester inhibits phosphatidylserine synthesis in human promyelocytic leukaemia HL60 cells. Possible involvement of free radicals and correlation with phosphorylation of nuclear protein 1b.

Treatment of human promyelocytic leukaemia HL60 cells in conditioned medium with 12-O-tetradecanoylphorbol 13-acetate (TPA) for 4 h resulted in 25-30% inhibition of labelling of phosphatidylserine (PS) with [U-14C]serine. PS labelling was 40% lower, and no inhibitory TPA effect was observed when the experiments were performed in fresh medium. Cycloheximide or puromycin also inhibited PS labelling by 38-44%; their inhibitory effects were non-additive with that of TPA and occurred only in conditioned medium. Catalase (CAT) and superoxide dismutase (SOD), both free-radical scavengers, and H7, a protein kinase C inhibitor, reversed to various extents the inhibitory effect of TPA on PS synthesis. On the other hand, chlorobenzoic acid, a free-radical-generating agent, also inhibited PS synthesis by 22% after 4 h treatment when conditioned medium was used. When ethanolamine was added to cells in conditioned medium to quench PS formation through the exchange of free serine with the ethanolamine moiety of phosphatidylethanolamine (PE), PS labelling was decreased by 33% and the inhibitory TPA effect was significantly decreased. On the other hand, ethanolamine had marginal quenching effect on PS labelling when added to cells in fresh medium. TPA increased the phosphorylation of various proteins in the cells, including protein lb (Mr 80,000; pI 5.5) shown to be localized mainly in the nuclear fraction. Chlorobenzoic acid selectively stimulated the phosphorylation of protein lb, whereas CAT and SOD specifically attenuated the TPA-stimulated phosphorylation of this protein. All these agents affected phosphorylation of protein lb only if conditioned medium was used. The findings suggested that net synthesis of PS through the base-exchange mechanism was stimulated in HL60 cells by cell products present in the conditioned medium. TPA inhibited this stimulated PS synthesis by a mechanism which appeared to involve active oxygen species and protein synthesis and might be related to the phosphorylation of protein lb.     

Molecular cloning and differential expression of somatic and testis-specific H2B histone genes during rat spermatogenesis

We have cloned cDNA of a testis-specific histone, TH2B (a variant of H2B), and rat somatic H2B gene to investigate regulation of testis-specific histone genes during rat spermatogenesis. The amino acid sequences deduced from DNA sequences show extensive sequence divergence in the N-terminal third of the two histones. The rest is highly conserved. One cysteine residue was found in TH2B. No cysteine is present in somatic histones except in H3 histone. We investigated the expression of TH2B and H2B genes using the regions of sequence divergence as hybridization probes. The TH2B gene is expressed only in the testis, and the expression of this gene is detected 14 days after birth, reaching a maximum at Day 20. The level of H2B mRNA shows a reciprocal pattern. This contrasting pattern can be explained by the gradually changing proportion of spermatogonia and spermatocytes with testicular maturation. In situ cytohybridization studies show that H2B gene is expressed primarily in proliferating spermatogonia and preleptotene spermatocytes, whereas TH2B gene is expressed exclusively in pachytene spermatocytes which first appear in testis about 14 days after birth. H2B and TH2B genes appear to be ideal markers for the study of proliferation and differentiation events in spermatogenesis and their regulatory mechanisms.     

Protein kinase C in fibroblasts. Characteristics of its intracellular location during growth and after exposure to phorbol esters and other mitogens

Using an N-bromosuccinimide cleavage fragment of histone H1 as a relatively specific substrate for protein kinase C, we evaluated the partitioning of this kinase activity between soluble and particulate cellular fractions in 3T3-L1 fibroblasts. In confluent, serum-deprived cells, protein kinase C activity was approximately equally divided between soluble and detergent-extractable particulate fractions; both rapidly growing and transformed cells appeared to contain higher levels of particulate enzyme activity. Soluble protein kinase C activity and immunoreactivity decreased to virtually undetectable levels after exposure of the cells to phorbol 12-myristate 13-acetate (PMA), associated with a commensurate increase in particulate kinase activity and immunoreactivity. In intact cells, PMA appeared to cause a shift of immunoreactive protein kinase C from the cytosol to the perinuclear region, as assessed by immunofluorescent microscopy; however; subcellular fractionation revealed that PMA caused increases in the protein kinase C activity associated primarily with non-nuclear membranes. Exposure of the cells to sn-1,2-dioctanoylglycerol resulted in a modest and transient membrane association of protein kinase C, whereas platelet-derived growth factor, fibroblast growth factor, and bombesin caused no detectable increases in the membrane association of the kinase. Activation of protein kinase C by growth factors in fibroblasts may occur without the gross disturbances in intracellular kinase location which occur in response to phorbol esters.