A pathway for conformational diversity in proteins mediated by intramolecular chaperones.

Conformational diversity within unique amino acid sequences is observed in diseases like scrapie and Alzheimer's disease. The molecular basis of such diversity is unknown. Similar phenomena occur in subtilisin, a serine protease homologous with eukaryotic pro-hormone convertases. The subtilisin propeptide functions as an intramolecular chaperone (IMC) that imparts steric information during folding but is not required for enzymatic activity. Point mutations within IMCs alter folding, resulting in structural conformers that specifically interact with their cognate IMCs in a process termed "protein memory." Here, we show a mechanism that mediates conformational diversity in subtilisin. During maturation, while the IMC is autocleaved and subsequently degraded by the active site of subtilisin, enzymatic properties of this site differ significantly before and after cleavage. Although subtilisin folded by Ile-48 --> Thr IMC (IMCI-48T) acquires an "altered" enzymatically active conformation (SubI-48T) significantly different from wild-type subtilisin (SubWT), both precursors undergo autocleavage at similar rates. IMC cleavage initiates conformational changes during which the IMC continues its chaperoning function subsequent to its cleavage from subtilisin. Structural imprinting resulting in conformational diversity originates during this reorganization stage and is a late folding event catalyzed by autocleavage of the IMC.     

Talin B is required for force transmission in morphogenesis of Dictyostelium

Talin plays a key role in the assembly and stabilisation of focal adhesions, but whether it is directly involved in force transmission during morphogenesis remains to be elucidated. We show that the traction force of Dictyostelium cells mutant for one of its two talin genes talB is considerably smaller than that of wild-type cells, both in isolation and within tissues undergoing morphogenetic movement. The motility of mutant cells in tightly packed tissues in vivo or under strong resistance conditions in vitro was lower than that of wild-type cells, but their motility under low external force conditions was not impaired, indicating inefficient transmission of force in mutant cells. Antibody staining revealed that the talB gene product (talin B) exists as small units subjacent to the cell membrane at adhesion sites without forming large focal adhesion-like assemblies. The total amount of talin B on the cell membrane was larger in prestalk cells, which exert larger force than prespore cells during morphogenesis. We conclude that talin B is involved in force transmission between the cytoskeleton and cell exterior.     

Cold-shock induced high-yield protein production in Escherichia coli

Overexpression of proteins in Escherichia coli at low temperature improves their solubility and stability. Here, we apply the unique features of the cspA gene to develop a series of expression vectors, termed pCold vectors, that drive the high expression of cloned genes upon induction by cold-shock. Several proteins were produced with very high yields, including E. coli EnvZ ATP-binding domain (EnvZ-B) and Xenopus laevis calmodulin (CaM). The pCold vector system can also be used to selectively enrich target proteins with isotopes to study their properties in cell lysates using NMR spectroscopy. We have cloned 38 genes from a range of prokaryotic and eukaryotic organisms into both pCold and pET14 (ref. 3) systems, and found that pCold vectors are highly complementary to the widely used pET vectors.     

Firefly luciferase is a bifunctional enzyme: ATP-dependent monooxygenase and a long chain fatty acyl-CoA synthetase

Firefly luciferase can catalyze the formation of fatty acyl-CoA via fatty acyl-adenylate from fatty acid in the presence of ATP, Mg²⁺ and coenzyme A (CoA). A long chain fatty acyl-CoA (C₁₆–C₂₀), produced by luciferase from a North American firefly (Photinus pyralis) and a Japanese firefly (Luciola cruciata), was isolated and identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis. Of a number of substrates tested, linolenic acid (C_18:3) and arachidonic acid (C_20:4) appear to be suitable for acyl-CoA synthesis. This evidence suggests that firefly luciferase within peroxisomes of the cells in the photogenic organ may be a bifunctional enzyme, catalyzing not only the bioluminescence reaction but also the fatty acyl-CoA synthetic reaction.     

CspD, a novel DNA replication inhibitor induced during the stationary phase in Escherichia coli

CspD is a stationary phase-induced, stress response protein in the CspA family of Escherichia coli. Here, we demonstrate that overproduction of CspD is lethal, with the cells displaying a morphology typical of cells with impaired DNA replication. CspD consists mainly of beta-strands, and the purified protein exists exclusively as a dimer and binds to single-stranded (ss)DNA and RNA in a dose-dependent manner without apparent sequence specificity. CsdD effectively inhibits both the initiation and the elongation steps of minichromosome replication in vitro. Electron microscopic studies revealed that CspD tightly packs ssDNA, resulting in structures distinctly different from those of SSB-coated DNA. We propose that CspD dimers, with two independent beta-sheets interacting with ssDNA, function as a novel inhibitor of DNA replication and play a regulatory role in chromosomal replication in nutrient-depleted cells.     

SigB, SigC, and SigE from Myxococcus xanthus homologous to sigma32 are not required for heat shock response but for multicellular differentiation

Myxococcus xanthus has been known to have multiple sigma factors which are considered to play important roles in regulation of gene expression in development. A new gene encoding a putative sigma factor, sigE, was cloned by using a degenerate oligonucleotide corresponding to the conserved region 2.2 of M. xanthus SigA. In the 2.0-kb nucleotide sequence, an open reading frame consisting of 280 amino acid residues was identified. The amino acid sequence of SigE shows high similarity to heat shock sigma factors in bacteria. However, the sigE gene is not induced by heat shock and deletion of sigE does not affect production of heat shock proteins. SigE is expressed during both vegetative growth and fruiting body development. In the deletion mutant of the sigE gene fruiting body formation is initiated earlier and fewer spores are produced than in the parent strain. Interestingly, the deltasigE mutant shows defects in fruiting body formation at 37 degrees C. In addition to SigE, SigB and SigC show high sequence similarity to heat shock sigma factors. However, even if all three sigma factor genes are disrupted, heat shock proteins are still normally induced. A deltasigBdeltasigCdeltasigE triple deletion strain forms fruiting bodies earlier, but sporulats later than the parent strain. Spores from the triple deletion mutant are aberrant and their viability is less than 0.001% compared with that of the parent strain, suggesting that these sigma factors may have redundant functions in multicellular differentiation of M. xanthus.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

The role of the G2 box,a conserved motif in the histidine kinase superfamily,in modulating the function of EnvZ

Sulphur is essential for some of the most vital biological activities such as translation initiation and redox maintenance, and genes involved in sulphur metabolism have been implicated in virulence. Mycobacterium tuberculosis has three predicted genes for the prototrophic acquisition of sulphur as sulphate: cysA, part of an ABC transporter, and cysA2 and A3, SseC sulphotransferases. Screening for amino acid auxotrophs of Mycobacterium bovis BCG, obtained by transposon mutagenesis, was used to select methionine auxotrophs requiring a sulphur-containing amino acid for growth. We have characterized one of these auxotrophs as being disrupted in cysA. Both the cysA mutant and a previously identified mutant in an upstream gene, subI, were functionally characterized as being completely unable to take up sulphate. Complementation of the cysA mutant with the wild-type gene from M. tuberculosis restored prototrophy and the ability to take up sulphate with the functional characteristics of an ABC transporter. Hence, it appears that this is the sole locus encoding inorganic sulphur transport in the M. tuberculosis complex.     

Molecular organization of amyloid protofilament-like assembly of betabellin 15D: helical array of beta-sandwiches

Betabellin is a 32-residue peptide engineered to fold into a four-stranded antiparallel beta-sheet protein. Upon air oxidation, the betabellin peptides can fold and assemble into a disulfide-bridged homodimer, or beta-sandwich, of 64 residues. Recent biophysical and ultrastructural studies indicate that betabellin 15D (B15D) (a homodimer of HSLTAKIpkLTFSIAphTYTCAVpkYTAKVSH, where p = DPro, k = DLys, and h = DHis) forms unbranched, 35-A wide assemblies that resemble the protofilaments of amyloid fibers. In the present study, we have analyzed in detail the X-ray diffraction patterns of B15D prepared from acetonitrile. The fiber diffraction analysis indicated that the B15D fibril was composed of a double helix defined by the selection rule l = n + 7m (where l is even, and n and m are any integers), and having a 199-A period and pitch, 28-A rise per unit, and 10-A radius. This helical model is equivalent to a reverse-handed, single helix with half the period and defined by the selection rule l = -3n + 7m (where l is any integer). The asymmetric unit is the single B15D beta-sandwich molecule. These results suggest that the betabellin assembly that models the protofilaments of amyloid fibers is made up of discrete subunits on a helical array. Multiple intersheet hydrogen bonds in the axial direction and intersandwich polar interactions in the lateral direction stabilize the array.