Ensuring the adaptive potential of Coastal wetlands of India- the need of the hour for sustainable management

India is endowed with a variety of coastal wetlands viz., mangroves, seagrasses, saltmarshes, coral reefs, lagoons and tidal flats, and the country is also a signatory to the Ramsar Convention on Wetlands and the Convention of Biological Diversity, besides having a robust framework of laws and policies, governing the wetland conservation. However, the conservation strategies can better be improved in the context of increasing pressures and threats and limited success of restoration/rehabilitation. Land conversion and ecological degradation of coastal wetlands are the stressors, associated with rapid coastal developmental activities and climate change. The coastal wetlands require desired habitat niche and hence, the conversion of coastal wetlands to other land uses (including agricultural and urban lands) may lead to permanent loss, whereas ecologically degraded coastal wetlands may be resilient if supported by effective protection measures. Preventing the habitat conversion and maximizing the adaptive potential (viz., the ability of populations or species to adapt to rapid environmental change with minimal disruption) by preserving the ecological health are the need of the hour to safeguard the existing coastal wetlands and sustain the provisional ecosystem services offered by them rather than short-term increase in area by unproductive restoration/rehabilitation efforts. Since coastal wetlands are flow through ecosystems, preserving the hydrological connectivity, facilitating the connectivity between adjacent ecosystems and protection of natural corridors are potential strategies that are required to enhance the adaptive potential of coastal wetlands. This analysis calls for site-specific, long-term and integrated ecosystem-based protection, management and rehabilitation strategies based on scientific principles and enforcing the effective legislative measures to regularize the coastal developmental activities in India.

     

Scope of Archaea in Fish Feed: a New Chapter in Aquafeed Probiotics?

Probiotics and Antimicrobial Proteins - The outbreak of diseases leading to substantial loss is a major bottleneck in aquaculture. Over the last decades, the concept of using feed probiotics was...     

A Dual Strategy to Cope with High Light in Chlamydomonas reinhardtii

Absorption of light in excess of the capacity for photosynthetic electron transport is damaging to photosynthetic organisms. Several mechanisms exist to avoid photodamage, which are collectively referred to as nonphotochemical quenching. This term comprises at least two major processes. State transitions (qT) represent changes in the relative antenna sizes of photosystems II and I. High energy quenching (qE) is the increased thermal dissipation of light energy triggered by lumen acidification. To investigate the respective roles of qE and qT in photoprotection, a mutant (npq4 stt7-9) was generated in Chlamydomonas reinhardtii by crossing the state transition–deficient mutant (stt7-9) with a strain having a largely reduced qE capacity (npq4). The comparative phenotypic analysis of the wild type, single mutants, and double mutants reveals that both state transitions and qE are induced by high light. Moreover, the double mutant exhibits an increased photosensitivity with respect to the single mutants and the wild type. Therefore, we suggest that besides qE, state transitions also play a photoprotective role during high light acclimation of the cells, most likely by decreasing hydrogen peroxide production. These results are discussed in terms of the relative photoprotective benefit related to thermal dissipation of excess light and/or to the physical displacement of antennas from photosystem II.     

Characterization of Solanum tuberosum Multicystatin and the Significance of Core Domains

Potato (Solanum tuberosum) multicystatin (PMC) is a unique cystatin composed of eight repeating units, each capable of inhibiting cysteine proteases. PMC is a composite of several cystatins linked by trypsin-sensitive (serine protease) domains and undergoes transitions between soluble and crystalline forms. However, the significance and the regulatory mechanism or mechanisms governing these transitions are not clearly established. Here, we report the 2.2-Å crystal structure of the trypsin-resistant PMC core consisting of the fifth, sixth, and seventh domains. The observed interdomain interaction explains PMC’s resistance to trypsin and pH-dependent solubility/aggregation. Under acidic pH, weakening of the interdomain interactions exposes individual domains, resulting in not only depolymerization of the crystalline form but also exposure of cystatin domains for inhibition of cysteine proteases. This in turn allows serine protease–mediated fragmentation of PMC, producing ∼10-kD domains with intact inhibitory capacity and faster diffusion, thus enhancing PMC’s inhibitory ability toward cysteine proteases. The crystal structure, light-scattering experiments, isothermal titration calorimetry, and site-directed mutagenesis confirmed the critical role of pH and N-terminal residues in these dynamic transitions between monomer/polymer of PMC. Our data support a notion that the pH-dependent structural regulation of PMC has defense-related implications in tuber physiology via its ability to regulate protein catabolism.     

Preparation and Antiviral Activity of Several Deoxygenated Ribavirin and Tiazofurin Derivatives

Abstract

Ribavirin and tiazofurin, two nucleosides of known antiviral activity, have been transformed by previously reported methods to yield several deoxy,epoxy, or dideoxy analogues. The deoxygenated derivatives were evaluated for antiviral activity against a host of DNA and RNA viruses; however, no significant in vitro activity was detected.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

Crystal structure of a type II dehydroquinate dehydratase-like protein from Bifidobacterium longum

Dehydroquinate dehydratase (DHQD) catalyzes the third step in the biosynthetic shikimate pathway. Here we identify a Bifidobacterium longum protein with high sequence homology to type II DHQDs but no detectable DHQD activity under standard assay conditions. A crystal structure reveals that the B. longum protein adopts a DHQD-like tertiary structure but a distinct quaternary state. Apparently forming a dimer, the B. longum protein lacks the active site aspartic acid contributed from a neighboring protomer in the type II DHQD dodecamer. Relating to the absence of protein–protein interactions established in the type II DHQD dodecameric assembly, substantial conformational changes distinguish the would-be active site of the B. longum protein. As B. longum possess no other genes with homology to known DHQDs, these findings imply a unique DHQD activity within B. longum.     

Recovery of Renal Function among ESRD Patients in the US Medicare Program

Background

Patients started on long term hemodialysis have typically had low rates of reported renal recovery with recent estimates ranging from 0.9–2.4% while higher rates of recovery have been reported in cohorts with higher percentages of patients with acute renal failure requiring dialysis.

Study Design

Our analysis followed approximately 194,000 patients who were initiated on hemodialysis during a 2-year period (2008 & 2009) with CMS-2728 forms submitted to CMS by dialysis facilities, cross-referenced with patient record updates through the end of 2010, and tracked through December 2010 in the CMS SIMS registry.

Results

We report a sustained renal recovery (i.e no return to ESRD during the available follow up period) rate among Medicare ESRD patients of > 5% - much higher than previously reported. Recovery occurred primarily in the first 2 months post incident dialysis, and was more likely in cases with renal failure secondary to etiologies associated with acute kidney injury. Patients experiencing sustained recovery were markedly less likely than true long-term ESRD patients to have permanent vascular accesses in place at incident hemodialysis, while non-White patients, and patients with any prior nephrology care appeared to have significantly lower rates of renal recovery. We also found widespread geographic variation in the rates of renal recovery across the United States.

Conclusions

Renal recovery rates in the US Medicare ESRD program are higher than previously reported and appear to have significant geographic variation. Patients with diagnoses associated with acute kidney injury who are initiated on long-term hemodialysis have significantly higher rates of renal recovery than the general ESRD population and lower rates of permanent access placement.