Circulating plasma microRNAs in colorectal neoplasia: A pilot study in assessing response to therapy

IntroductionCurrent serological surveillance markers to monitor colorectal cancer (CRC) or colorectal advanced adenomas (CAA) are hampered by poor sensitivity and specificity. The aim of this study is to identify and validate a panel of plasma microRNAs which change in expression after resection of such lesions.MethodsA prospectively maintained colorectal surgery database was queried for patients in whom both pre- and post-procedural serum samples had been obtained. An initial screening analysis of CRC and CAA patients (5 each) was conducted using screening cards for 380 miRNAs. Four identified miRNAs were combined with a previously described panel of 7 miRNAs that were diagnostically predictive of CRC and CAA. Differential miRNA expression was assessed using quantitative real-time polymerase chain reaction(qRT-PCR).ResultsFifty patients were included (n = 27 CRC, n = 23 CAA). There was no difference in age, gender, or race profile of CRC patients compared to CAA patients. Six miRNA were significantly increased after CRC resection (miR-324, let7b, miR-454, miR-374a, miR-122, miR-19b, all p<0.05), while three miRNAs were significantly increased following CAA resection (miR-454, miR-374a, miR-122, all p<0.05). Three miRNA were increased in common for both (miR-454, miR-374a, miR-122).DiscussionThe expression of miRNAs associated with neoplasia (either CRC or CAA) was significantly increased following surgical resection or endoscopic removal of CRC or CAA. Future studies should focus on the evaluation of these miRNAs in CRC and CAA prognosis.     

Characterization of Solanum tuberosum Multicystatin and the Significance of Core Domains

Potato (Solanum tuberosum) multicystatin (PMC) is a unique cystatin composed of eight repeating units, each capable of inhibiting cysteine proteases. PMC is a composite of several cystatins linked by trypsin-sensitive (serine protease) domains and undergoes transitions between soluble and crystalline forms. However, the significance and the regulatory mechanism or mechanisms governing these transitions are not clearly established. Here, we report the 2.2-Å crystal structure of the trypsin-resistant PMC core consisting of the fifth, sixth, and seventh domains. The observed interdomain interaction explains PMC’s resistance to trypsin and pH-dependent solubility/aggregation. Under acidic pH, weakening of the interdomain interactions exposes individual domains, resulting in not only depolymerization of the crystalline form but also exposure of cystatin domains for inhibition of cysteine proteases. This in turn allows serine protease–mediated fragmentation of PMC, producing ∼10-kD domains with intact inhibitory capacity and faster diffusion, thus enhancing PMC’s inhibitory ability toward cysteine proteases. The crystal structure, light-scattering experiments, isothermal titration calorimetry, and site-directed mutagenesis confirmed the critical role of pH and N-terminal residues in these dynamic transitions between monomer/polymer of PMC. Our data support a notion that the pH-dependent structural regulation of PMC has defense-related implications in tuber physiology via its ability to regulate protein catabolism.     

Consequences of MnSOD interactions with nitric oxide: Nitric oxide dismutation and the generation of peroxynitrite and hydrogen peroxide

The present study demonstrates that manganese superoxide dismutase (MnSOD) (Escherichia coli), binds nitric oxide (^√NO) and stimulates its decay under both anaerobic and aerobic conditions. The results indicate that previously observed MnSOD-catalyzed ^√NO disproportionation (dismutation) into nitrosonium (NO⁺) and nitroxyl (NO^? ) species under anaerobic conditions is also operative in the presence of molecular oxygen. Upon sustained aerobic exposure to ^√NO, MnSOD-derived NO^? species initiate the formation of peroxynitrite (ONOO^? ) leading to enzyme tyrosine nitration, oxidation and (partial) inactivation. The results suggest that both ONOO^? decomposition and ONOO^? -dependent tyrosine residue nitration and oxidation are enhanced by metal centre-mediated catalysis. We show that the generation of ONOO^? is accompanied by the formation of substantial amounts of H₂O₂. MnSOD is a critical mitochondrial antioxidant enzyme, which has been found to undergo tyrosine nitration and inactivation in various pathologies associated with the overproduction of ^√NO. The results of the present study can account for the molecular specificity of MnSOD nitration in vivo. The interaction of ^√NO with MnSOD may represent a novel mechanism by which MnSOD protects the cell from deleterious effects associated with overproduction of ^√NO.     

CHEMICAL MODIFICATION OF L-ASPARAGINASE FROM Cladosporium sp. FOR IMPROVED ACTIVITY AND THERMAL STABILITY

L-Asparaginase (ASNase), an antileukemia enzyme, is facing problems with antigenicity in the blood. Modification of L-asparaginase from Cladosporium sp. was tried to obtain improved stability and improved functionality. In our experiment, modification of the enzyme was tried with bovine serum albumin, ovalbumin by crosslinking using glutaraldehyde, N-bromosuccinimide, and mono-methoxy polyethylene glycol. Modified enzymes were studied for activity, temperature stability, rate constants (k_d), and protection to proteolytic digestion. Modification with ovalbumin resulted in improved enzyme activity that was 10-fold higher compared to native enzyme, while modification with bovine serum albumin through glutaraldehyde cross-linking resulted in high stability of L-asparaginase that was 8.5- and 7.62-fold more compared to native enzyme at 28°C and 37°C by the end of 24 hr. These effects were dependent on the quantity of conjugate formed. Modification also markedly prolonged L-asparaginase half-life and serum stability. N-Bromosuccinimide-modified ASNase presented greater stability with prolonged in vitro half-life of 144 hr to proteolytic digestion relative to unmodified enzyme (93 h). The present work could be seen as producing a modified L-asparaginase with improved activity and stability and can be a potential source for developing therapeutic agents for cancer treatment.     

Proteomic profiling and functional characterization of early and late shoulder osteoarthritis

Introduction

The development of effective treatments for osteoarthritis (OA) has been hampered by a poor understanding of OA at the cellular and molecular levels. Emerging as a disease of the ''whole joint’, the importance of the biochemical contribution of various tissues, including synovium, bone and articular cartilage, has become increasingly significant. Bathing the entire joint structure, the proteomic analysis of synovial fluid (SF) from osteoarthritic shoulders offers a valuable ''snapshot’ of the biologic environment throughout disease progression. The purpose of this study was to identify differentially expressed proteins in early and late shoulder osteoarthritic SF in comparison to healthy SF.

Methods

A quantitative ¹⁸O labeling proteomic approach was employed to identify the dysregulated SF proteins in early (n = 5) and late (n = 4) OA patients compared to control individuals (n = 5). In addition, ELISA was used to quantify six pro-inflammatory and two anti-inflammatory cytokines.

Results

Key results include a greater relative abundance of proteins related to the complement system and the extracellular matrix in SF from both early and late OA. Pathway analyses suggests dysregulation of the acute phase response, liver x receptor/retinoid x receptor (LXR/RXR), complement system and coagulation pathways in both early and late OA. The network related to lipid metabolism was down-regulated in both early and late OA. Inflammatory cytokines including interleukin (IL) 6, IL 8 and IL 18 were up-regulated in early and late OA.

Conclusions

The results suggest a dysregulation of wound repair pathways in shoulder OA contributing to the presence of a ''chronic wound’ that progresses irreversibly from early to later stages of OA. Protease inhibitors were downregulated in late OA suggesting uncontrolled proteolytic activity occurring in late OA. These results contribute to the theory that protease inhibitors represent promising therapeutic agents which could limit proteolytic activity that ultimately leads to cartilage destruction.     

Oligonucleotide Conjugates: Alteration of the Pharmacokinetic Properties of Antisense Agents

Abstract

Cholic acid, cholesterol, several polyamines and polyethylene glycols were conjugated to antisense oligonucleotides targeted to human or murine intercellular adhesion molecule-1 (ICAM-1) mRNA to study their effects on cellular absorption.     

An Improved Synthesis of 1-(2-Deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione and Its Incorporation Into G-Rich Triple Helix Forming Oligonucleotides

Abstract

A convenient synthesis of 1-(2-deoxy-β-D-erythro-pentofuranosyl)quinazoline-2,4(3H)-dione ( 6 ) has been accomplished. The structural conformation of ( 6 ) was derived by 2D NMR, COSY and NOESY experiments. Nucleoside ( 6 ) was incorporated into G-rich triplex forming oligonucleotides (TFOs) by solid-support, phosphoramidite method. The triplex forming capabilities of modified TFOs (S2, S3 and S4) has been evaluated in antiparallel motif with a target duplex (duplex-31) 5′d(GTCACTGGCCCTTCCTCCTTCCCGGTCTCAG)3′-5′d(CAGTGACCGGGAAGGAGGAAGGGCCAGAGT)3′ (D1) at pH 7.6. The parallel triplex formation of a shorter TFO (S6) containing Q has also been studied with a target duplex-11 (D2) at pH 5.0.     

The Novel 6–(N-Pyrrolyl)purine Acyclic Nucleosides: 1H and 13C NMR and X-ray Structural Study†

Abstract

Synthesis of the novel nucleoside analogues containing exocyclic pyrrolo moiety and acyclic side chains attached to the purine ring at N-9 and N-7 is described. The site of alkylation was determined by ¹H and ¹³C NMR on the basis of chemical shifts, C-H coupling constants and connectivity in NOESY and HETCOR spectra. The N-9 substitution of 7 was proved by its X-ray crystallographic analysis.

     

Characterizing the normal proteome of human ciliary body

Background

The ciliary body is the circumferential muscular tissue located just behind the iris in the anterior chamber of the eye. It plays a pivotal role in the production of aqueous humor, maintenance of the lens zonules and accommodation by changing the shape of the crystalline lens. The ciliary body is the major target of drugs against glaucoma as its inhibition leads to a drop in intraocular pressure. A molecular study of the ciliary body could provide a better understanding about the pathophysiological processes that occur in glaucoma. Thus far, no large-scale proteomic investigation has been reported for the human ciliary body.

Results

In this study, we have carried out an in-depth LC-MS/MS-based proteomic analysis of normal human ciliary body and have identified 2,815 proteins. We identified a number of proteins that were previously not described in the ciliary body including importin 5 (IPO5), atlastin-2 (ATL2), B-cell receptor associated protein 29 (BCAP29), basigin (BSG), calpain-1 (CAPN1), copine 6 (CPNE6), fibulin 1 (FBLN1) and galectin 1 (LGALS1). We compared the plasma proteome with the ciliary body proteome and found that the large majority of proteins in the ciliary body were also detectable in the plasma while 896 proteins were unique to the ciliary body. We also classified proteins using pathway enrichment analysis and found most of proteins associated with ubiquitin pathway, EIF2 signaling, glycolysis and gluconeogenesis.

Conclusions

More than 95% of the identified proteins have not been previously described in the ciliary body proteome. This is the largest catalogue of proteins reported thus far in the ciliary body that should provide new insights into our understanding of the factors involved in maintaining the secretion of aqueous humor. The identification of these proteins will aid in understanding various eye diseases of the anterior segment such as glaucoma and presbyopia.     

Synconset Waves and Chains: Spiking Onsets in Synchronous Populations Predict and Are Predicted by Network Structure

Synfire waves are propagating spike packets in synfire chains, which are feedforward chains embedded in random networks. Although synfire waves have proved to be effective quantification for network activity with clear relations to network structure, their utilities are largely limited to feedforward networks with low background activity. To overcome these shortcomings, we describe a novel generalisation of synfire waves, and define ‘synconset wave’ as a cascade of first spikes within a synchronisation event. Synconset waves would occur in ‘synconset chains’, which are feedforward chains embedded in possibly heavily recurrent networks with heavy background activity. We probed the utility of synconset waves using simulation of single compartment neuron network models with biophysically realistic conductances, and demonstrated that the spread of synconset waves directly follows from the network connectivity matrix and is modulated by top-down inputs and the resultant oscillations. Such synconset profiles lend intuitive insights into network organisation in terms of connection probabilities between various network regions rather than an adjacency matrix. To test this intuition, we develop a Bayesian likelihood function that quantifies the probability that an observed synfire wave was caused by a given network. Further, we demonstrate it''s utility in the inverse problem of identifying the network that caused a given synfire wave. This method was effective even in highly subsampled networks where only a small subset of neurons were accessible, thus showing it''s utility in experimental estimation of connectomes in real neuronal-networks. Together, we propose synconset chains/waves as an effective framework for understanding the impact of network structure on function, and as a step towards developing physiology-driven network identification methods. Finally, as synconset chains extend the utilities of synfire chains to arbitrary networks, we suggest utilities of our framework to several aspects of network physiology including cell assemblies, population codes, and oscillatory synchrony.