Candidose et tumeur obstructive intestinales chez un Babouin captif, ‘Papio Papio’ (Desm.)

Résumé Une candidose intestinale associée à une tumeur épithéliale, à métaplasie glandulaire, à pouvoir invasif marqué, provoquant une gêne du transit, a été découverte chez un Babouin de Guinée,Papio papio (Desm.) de la collection du Parc zoologique de Paris. A cette occasion nous avons rapporté les résultats concernant deux autres affections du tube digestid de nos Babouins captifs.

---

Report of a case of candidiasis of the digestive tract associated to an obstructive epithelial tumor, with great invasive ability, in a captive Baboon,Papio papio (Desm.). Included is a discussion of the incidence of some intestinal disturbances involving candidiasis of subhuman Primates.

     

The role of glucagon in the regulation of blood glucose: Model studies

Mathematical models afford a procedure of unifying concepts and hypotheses by expressing quantitative relationships between observables. The model presented indicates the roles of both insulin and glucagon as regulators of blood glucose, albeit in different ranges of the blood glucose concentrations. Insulin secretion is induced during hyperglycemia, while glucagon secretion results during hypoglycemia. These are demonstrated by simulations of a mathematical model conformed to data from the oral glucose tolerance test and the insulin infusion test in normal control subjects and stable and unstable diabetic patients. The model studies suggest the parameters could prove of value in quantifying the diabetic condition by indicating the degree of instability. Presented at the Society for Mathematical Biology Meeting, University of Pennsylvania, Philadelphia, August 19–21, 1976.     

Cellulose acetate electrophoresis of protein kinases: Detection of the active forms using various substrates

Electrophoresis on cellulose acetate strips was used to analyze protein kinases from normal rat liver. In addition to already well-characterized cAMP-dependent protein kinases type I and II and cAMP-independent casein kinases I and II, this method enabled the detection of several supplementary bands corresponding to kinases which were investigated according to their substrate specificity, activation by cAMP, and inhibition by the specific inhibitor of the catalytic subunit of cAMP-dependent protein kinases or by heparin. Using this rapid, sensitive, and resolutive electrophoretic method, different isozyme patterns could be obtained starting from minute amounts of different types of biological material.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Glucocorticoid hormones increase the activity of γ-glutamyltransferase in a highly differentiated hepatoma cell line

γ-Glutamyltransferase activity was detected in the plasma membrane of the highly differentiated hepatoma cell line Fao, (0.93 mU/mg cell protein). Dexamethasone (1 μM) provoked a 2–3-fold increase in the activity of the enzyme in the presence of fetal calf serum. Maximal induction occurred 48–72 h after addition of the glucocorticoid to the cell culture medium. The hormonal specificity was demonstrated by the relative potencies of several glucocorticoids and sex steroids: hydrocortisone and corticosterone increased γ-glutamyltransferase activity while tetrahydrocorticosterone and all sex steroids tested were ineffective. The effect of dexamethasone on γ-glutamyltransferase activity was specific since the activities of several other plasma membrane enzymes were not modified. The mechanism of the dexamethasone-induced increase in γ-glutamyltransferase activity was neither by modification of the affinity of the enzyme for its substrates nor by alteration of the subcellular distribution of the enzyme. This increase was prevented by cycloheximide and actinomycin D. The data presented are consistent with a specific glucocorticoid receptor-mediated induction of γ-glutamyltransferase activity in Fao cells. The kinetic parameters of the induction process by glucocorticoids are very similar to those found in adult rat liver. These results suggest that the Fao cell line is a very convenient system for the study of the molecular mechanisms of glucocorticoid effects on differentiated cells.     

Interaction between macrophages and Schistosoma mansoni schistosomula: Role of IgG peptides and aggregates on the modulation of β-glucuronidase release and the cytotoxicity against schistosomula

Discharge of lysosomal enzymes, measured by release of β-glucuronidase and cytotoxicity against Schistosoma mansoni schistosomula, was studied when rat macrophages were incubated in the presence of either IgG peptides, resulting from the cleavage of nonimmune IgG by parasitic proteases, or nonimmune aggregated IgG. With peptides, the macrophage activity showed a dramatic decrease while they were stimulated by IgG aggregates. In contrast, the synthesis of lymphocyte activating factor by macrophages was unaffected. The hydrolysis of IgG is carried out by two distinct enzymatic molecules released into the medium by the larvae. The mechanism by which nonimmune IgG peptides or aggregates inhibit or stimulate macrophage activity, regulated by both parameters indicated above, is discussed and is suggested as a general regulation mechanism for the macrophage activity required for parasite survival in the host.