Characterization of a cDNA encoding a putative chitinase from teratocytes of the endoparasitoid Toxoneuron nigriceps

Females of insect endoparasitoids inject substances along with the egg at oviposition, which can regulate or induce changes in a number of host physiological processes to benefit the developing parasitoid. These changes can be caused by substances such as venoms, calyx fluids, or symbiotic‐associated virus particles (polydnavirus), which are injected by females along with their eggs, and by substances secreted by parasitoid‐derived tissues (teratocytes) or the developing parasitoid larvae. Teratocytes (dissociated cells of the serosal membrane after parasitoid eclosion) release substances that have roles (i) in parasitoid nutrition, (ii) in the digestion of host tissues, and (iii) in the regulation of host development. Teratocytes of Toxoneuron nigriceps (Viereck) (Hymenoptera: Braconidae) have been implicated in the arrestment of the host development and in the regulation of circulating levels of host ecdysteroids. Here we describe the cDNA of a teratocyte‐secreted chitinase and its expression during parasitoid development, and discuss its putative role in this host–parasitoid association.     

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.     

Similar hypotensive responses to resistance exercise with and without blood flow restriction

Low intensity resistance exercise (RE) with blood flow restriction (BFR) has gained attention in the literature due to the beneficial effects on functional and morphological variables, similar to those observed during traditional RE without BFR, while the effects of BFR on post-exercise hypotension remain unclear. The aim of the present study was to compare the blood pressure (BP) response of trained normotensive individuals to RE with and without BFR. In this cross-over randomized trial, eight male subjects (23.8 ± 4 years, 74 ± 3 kg, 174 ± 4 cm) completed two exercise protocols: traditional RE (3 x 10 repetitions at 70% one-repetition maximum [1-RM]) and low intensity RE (3 x 15 repetitions at 20% 1-RM) with BFR. Blood pressure measurements were performed after 15 min of seated rest (0), immediately after and 10 min, 20 min, 30 min, 40 min, 50 min and 60 min after the experimental sessions. Similar hypotensive effects for systolic BP (SBP) were observed for both protocols (P < 0.05) after exercise, with no differences between groups (P > 0.05) and no statistically significant difference for diastolic BP (P > 0.05). These results suggest that in normotensive trained individuals, both traditional RE and RE with BFR induce hypotension for SBP, which is important to prevent cardiovascular disturbances.     

ANAEROBIOSIS AS A STIMULUS TO GERMINATION IN TWO VERNAL POOL GRASSES

Tuctoria greenei and Orcuttia californica are two aquatic annual grasses in the small tribe Orcuttieae. They are endemic to seasonal pool habitats in California and Baja California. In years of poor rainfall their seed banks remain dormant until a season of rainfall which is adequate to fill the pool basins. This study attempts to elucidate the factors responsible for cuing germination. Tuctoria greenei germination is almost entirely dependent upon a combination of anaerobic conditions and light. It is suggested that in nature, such cues would be relatively specific to the uppermost soil substrate overlain by water. Orcuttia californica germination exhibits far less dependence upon anaerobic conditions. There is some indirect evidence that fungi may play an important role in stimulating germination of this species.     

Species–area relationships in Mediterranean-climate plant communities

Aim To determine the best‐fit model of species–area relationships for Mediterranean‐type plant communities and evaluate how community structure affects these species–area models. Location Data were collected from California shrublands and woodlands and compared with literature reports for other Mediterranean‐climate regions. Methods The number of species was recorded from 1, 100 and 1000 m² nested plots. Best fit to the power model or exponential model was determined by comparing adjusted r² values from the least squares regression, pattern of residuals, homoscedasticity across scales, and semi‐log slopes at 1–100 m² and 100–1000 m². Dominance–diversity curves were tested for fit to the lognormal model, MacArthur's broken stick model, and the geometric and harmonic series. Results Early successional Western Australia and California shrublands represented the extremes and provide an interesting contrast as the exponential model was the best fit for the former, and the power model for the latter, despite similar total species richness. We hypothesize that structural differences in these communities account for the different species–area curves and are tied to patterns of dominance, equitability and life form distribution. Dominance–diversity relationships for Western Australian heathlands exhibited a close fit to MacArthur's broken stick model, indicating more equitable distribution of species. In contrast, Californian shrublands, both postfire and mature stands, were best fit by the geometric model indicating strong dominance and many minor subordinate species. These regions differ in life form distribution, with annuals being a major component of diversity in early successional Californian shrublands although they are largely lacking in mature stands. Both young and old Australian heathlands are dominated by perennials, and annuals are largely absent. Inherent in all of these ecosystems is cyclical disequilibrium caused by periodic fires. The potential for community reassembly is greater in Californian shrublands where only a quarter of the flora resprout, whereas three quarters resprout in Australian heathlands. Other Californian vegetation types sampled include coniferous forests, oak savannas and desert scrub, and demonstrate that different community structures may lead to a similar species–area relationship. Dominance–diversity relationships for coniferous forests closely follow a geometric model whereas associated oak savannas show a close fit to the lognormal model. However, for both communities, species–area curves fit a power model. The primary driver appears to be the presence of annuals. Desert scrub communities illustrate dramatic changes in both species diversity and dominance–diversity relationships in high and low rainfall years, because of the disappearance of annuals in drought years. Main conclusions Species–area curves for immature shrublands in California and the majority of Mediterranean plant communities fit a power function model. Exceptions that fit the exponential model are not because of sampling error or scaling effects, rather structural differences in these communities provide plausible explanations. The exponential species–area model may arise in more than one way. In the highly diverse Australian heathlands it results from a rapid increase in species richness at small scales. In mature California shrublands it results from very depauperate richness at the community scale. In both instances the exponential model is tied to a preponderance of perennials and paucity of annuals. For communities fit by a power model, coefficients z and log c exhibit a number of significant correlations with other diversity parameters, suggesting that they have some predictive value in ecological communities.     

Feeding effects on the neuroendocrine regulated development of fat body mitochondria in the cockroach Blaberus discoidalis

Fat body mitochondria in male Blaberus discoidalis showed a stepwise three-fold development in succinoxidase activity during the first 10 days of adult life. Long-term corpora cardiaca deficiency or prevention of feeding by oral blockage prevented the third step in succinoxidase development. Starvation alone did not prevent the complete development. Administration of corpora cardiaca extracts to orally blocked animals stimulated the final development of succinoxidase activity. It is speculated that the mechanical acts of feeding stimulate neurosecretory activity which increases the metabolic capacity of the fat body through effects on mitochondriogenesis.     

Structural determinants of cross-linking and hydrophobic domains for self-assembly of elastin-like polypeptides

Elastin is a major structural protein found in large blood vessels, lung, ligaments, and skin, imparting the physical properties of extensibility and elastic recoil to these tissues. To achieve the required structural durability of the elastic matrix, the elastin monomer, tropoelastin, undergoes ordered assembly into a covalently cross-linked, fibrillar polymeric structure. Human tropoelastin consists of 34 exons coding for alternating hydrophobic and cross-linking domains. Using a series of well-defined recombinant polypeptides based on human elastin sequences mimicking native elastin, we have previously investigated the role of sequence and context of hydrophobic domains in elastin self-assembly. Here, we demonstrate that the structure of both cross-linking and hydrophobic domains have significant effects on the assembly of these polypeptides. Removing a putative flexible hinge region in the center of a cross-linking domain substantially increased the alpha-helical content and strongly promoted their self-aggregation. However, while trifluoroethanol (TFE) promoted and urea inhibited self-assembly of these polypeptides, these effects were not predominantly due to altered alpha-helicity of the polypeptides. Our results suggest that, while increased alpha helicity also favors this process, the major effect of TFE to promote organized self-assembly of elastin-like polypeptides is likely related to direct effects of this cosolvent on hydrophobic domains. Such simple elastin polypeptide models can provide an important tool for understanding the relationships between sequence, structure, and polymeric assembly of elastin.