Long-term post-synaptic consequences of methamphetamine on preprotachykinin mRNA expression

Exposure to repeated high doses of methamphetamine produces long-term toxicity to central monoamine systems and alters striatonigral pathway function 3 weeks after exposure. To determine whether these changes in the striatonigral pathway persist for longer we examined neuropeptide mRNA expression in the striatum and cytochrome oxidase activity in the output nuclei of the basal ganglia after treatment with multiple high doses of methamphetamine. Rats exposed to multiple high doses of methamphetamine had significant depletion in dopamine and serotonin content, decreases in tyrosine hydroxylase immunoreactivity, and decreases in preprotachykinin mRNA expression, 6 and 12 weeks after methamphetamine treatment. Preprotachykinin mRNA expression was significantly reduced by approximately 20% in the middle striatum and approximately 32% in the caudal striatum, 6 weeks after treatment. Twelve weeks after treatment, preprotachykinin mRNA expression continued to be significantly reduced by approximately 20% in the middle striatum and approximately 14% in the caudal striatum. Cytochrome oxidase histochemical staining in the entopeduncular nucleus and substantia nigra pars reticulata was not significantly different from that in controls at either time point. These data suggest that neurotoxic regimens of methamphetamine induce changes in striatonigral neurons that persist for up to 3 months, although there is some recovery.     

A new method for evaluation of cavitation near mechanical heart valves

Evaluation of cavitation in vivo is often based on recordings of high-pass filtered random high-frequency pressure fluctuations. We hypothesized that cavitation signal components are more appropriately assessed by a new method for extraction of random signal components of the pressure signals. We investigated three different valve types and found a high correlation between the two methods (r2: 0.8806-0.9887). The new method showed that the cavitation signal could be extracted without a priori knowledge needed for setting the high-pass filter cut off frequency, nor did it introduce bandwidth limitation of the cavitation signal.     

The unusual cartilaginous tissues of jawless craniates, cephalochordates and invertebrates

A collagenous extracellular matrix was previously considered to be a requirement for classification of true cartilage. Data from the lamprey and hagfish now clearly indicate that both of these jawless craniates have extensive non-collagenous, yet cartilaginous endoskeletons. Non-collagenous cartilages are present in the cephalochordates (amphioxus) and in the invertebrates, although collagen-containing cartilages also are found in the invertebrates. This review summarizes current knowledge of the morphological, biochemical and molecular characteristics of the unusual non-collagenous cartilages in jawless craniates and the cartilaginous tissues in amphioxus and invertebrates. A least two types of non-collagenous cartilage matrix proteins are found in both the hagfishes and the lampreys, all of which are resistant to digestion by cyanogen bromide (CNBr). Although all four of these matrices show some similarities with each other, suggesting a family of non-collagenous, elastin-like proteins, it is clear that the major matrix proteins of each are different. New morphological and biochemical information on the cartilaginous tissues in squid, horseshoe crab and amphioxus reveals the presence of CNBr-insoluble, non-collagenous matrix proteins, potentially extending the jawless craniate family of cartilaginous proteins into the invertebrates. Details of the evolutionary relationships between these non-collagenous matrix proteins and the significance of the occurrence of these proteins as the major components of the cartilaginous tissues of jawless craniates, amphioxus, horseshoe crab and squid, all of which are capable of producing a variety of collagens in other tissues, remain to be investigated.     

Increased birefringence in the meiotic spindle provides a new marker for the onset of activation in living oocytes

The newly developed Pol-Scope allows imaging of spindle retardance, which is an optical property of organized macromolecular structures that can be observed in living cells without fixation or staining. Experiments were undertaken to examine changes in meiotic spindles during the initial stages of activation of living mouse oocytes using the Pol-Scope. Parthenogenetic activation of oocytes treated with calcium ionophore evoked a dynamic increase in meiotic spindle retardance, particularly of the midregion, before spindle rotation and second polar body extrusion. The pronounced increase in spindle retardance, which could, for the first time to our knowledge, be quantified in living oocytes, was maintained during polar body extrusion. Spindle retardance of newly in vivo fertilized oocytes was significantly higher than that of ovulated, metaphase II oocytes. Pol-Scope imaging of fertilized oocytes did not affect subsequent development. These results establish that increased spindle retardance precedes polar body extrusion and pronuclear formation. The increased birefringence in the spindle provides an early indicator of oocyte activation. Thus, noninvasive, quantitative imaging of the onset of activation in living oocytes might improve the efficiency of assisted fertilization and other embryo technologies.     

Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability

Synthesis of aortic elastin peaks in the perinatal period and then is strongly down-regulated with postnatal development and growth. Decreased stability of elastin mRNA contributes to this developmental decrease in chick aortic elastin production. We have previously shown that destabilization of elastin mRNA is correlated with decreased binding of cytosolic protein(s) to a large, GC-rich region of secondary structure in the 3'-untranslated region (3'-UTR) of elastin mRNA. In this study, using gel migration shift assays, deletion constructs, and antisense competition assays, we identify a major protein-binding site in the 3'-UTR of elastin as a GA-rich sequence (UGGGGGGAGGGAGGGAGGGA), which we have designated the G3A motif. This motif is present in the 3'-UTR of elastin from several species. Binding proteins are present in both nuclear and cytoplasmic extracts, and their abundance is associated with tissues producing elastin and correlated with circumstances in which elastin mRNA is stable. These results suggest that the conserved GA-rich sequence of the elastin 3'-UTR is an important element in the regulation of stability of the elastin mRNA.     

A non-invasive method for measuring preimplantation embryo physiology

The physiology of the early embryo may be indicative of embryo vitality and therefore methods for non-invasively monitoring physiological parameters from embryos could improve preimplantation diagnoses. The self-referencing electrophysiological technique is capable of non-invasive measurement of the physiology of individual cells by monitoring the movement of ions and molecules between the cell and the surrounding media. Here we use this technique to monitor gradients of calcium, potassium, oxygen and hydrogen peroxide around individual mouse preimplantation embryos. The calcium-sensitive electrode in self-referencing mode identified a region of elevated calcium concentration (approximately 0.25 pmol) surrounding each embryo. The calcium gradient surrounding embryos was relatively steep, such that the region of elevated calcium extended into the medium only 4 microns from the embryo. By contrast, using an oxygen-sensitive electrode an extensive gradient of reduced dissolved oxygen concentration was measured surrounding the embryo and extended tens of micrometres into the medium. A gradient of neither potassium nor hydrogen peroxide was observed around unperturbed embryos. We also demonstrate that monitoring the physiology of embryos using the self-referencing technique does not compromise their subsequent development. Blastocyts studied with the self-referencing technique implanted and developed to term at the same frequency as did unexamined, control embryos. Therefore, the self-referencing electrode provides a valuable non-invasive technique for studying the physiology and pathophysiology of individual embryos without hindering their subsequent development.     

Organization of the subumbrellar musculature in the ephyra,juvenile, and adult stages of Aurelia aurita Medusae

We used fluorescently labeled phalloidin to examine the subumbrellar musculature of the scyphozoan jellyfish Aurelia aurita in a developmental series from ephyra to adult medusa. In the ephyra, the swim musculature includes a disc‐like sheet of circular muscle, in addition to two radial bands of muscle in each of the eight ephyral arms. The radial muscle bands join with the circular muscle, and both circular and radial muscle act together during each swim contraction. As the ephyra grows into a juvenile medusa, arms tissue is resorbed as the bell tissue grows outward, so eventually, the ephyral arms disappear. During this process, the circular muscle disc also grows outward and the radial muscle bands of the arms also disappear. At this time, a marginal gap appears at the bell margin, which is devoid of circular muscle cells, but has a loose arrangement of radial muscle fibers. This marginal gap is preserved as the medusa grows, and contributes to the floppy nature of the bell margin. Radial distortions in the circular muscle layer involve muscle fibers that run in random directions, with a primarily radial orientation. These are believed to be remnants of the radial muscle of the ephyral arms, and the distortions decrease in number and extent as the medusa grows. Since the mechanics of swimming changes from drag‐based paddling in the ephyra to marginal rowing in the adult medusa, the development of the marginal gap and the presence of radial distortions should be considered in terms of this mechanical transition.     

Genome-Wide Diversity and Phylogeography of Mycobacterium avium subsp. paratuberculosis in Canadian Dairy Cattle

Mycobacterium avium subsp. paratuberculosis (MAP) is the causative bacterium of Johne’s disease (JD) in ruminants. The control of JD in the dairy industry is challenging, but can be improved with a better understanding of the diversity and distribution of MAP subtypes. Previously established molecular typing techniques used to differentiate MAP have not been sufficiently discriminatory and/or reliable to accurately assess the population structure. In this study, the genetic diversity of 182 MAP isolates representing all Canadian provinces was compared to the known global diversity, using single nucleotide polymorphisms identified through whole genome sequencing. MAP isolates from Canada represented a subset of the known global diversity, as there were global isolates intermingled with Canadian isolates, as well as multiple global subtypes that were not found in Canada. One Type III and six “Bison type” isolates were found in Canada as well as one Type II subtype that represented 86% of all Canadian isolates. Rarefaction estimated larger subtype richness in Québec than in other Canadian provinces using a strict definition of MAP subtypes and lower subtype richness in the Atlantic region using a relaxed definition. Significant phylogeographic clustering was observed at the inter-provincial but not at the intra-provincial level, although most major clades were found in all provinces. The large number of shared subtypes among provinces suggests that cattle movement is a major driver of MAP transmission at the herd level, which is further supported by the lack of spatial clustering on an intra-provincial scale.     

Sequence and domain arrangements influence mechanical properties of elastin‐like polymeric elastomers

Elastin is the polymeric, extracellular matrix protein that provides properties of extensibility and elastic recoil to large arteries, lung parenchyma, and other tissues. Elastin assembles by crosslinking through lysine residues of its monomeric precursor, tropoelastin. Tropoelastin, as well as polypeptides based on tropoelastin sequences, undergo a process of self‐assembly that aligns lysine residues for crosslinking. As a result, both the full‐length monomer as well as elastin‐like polypeptides (ELPs) can be made into biomaterials whose properties resemble those of native polymeric elastin. Using both full‐length human tropoelastin (hTE) as well as ELPs, we and others have previously reported on the influence of sequence and domain arrangements on self‐assembly properties. Here we investigate the role of domain sequence and organization on the tensile mechanical properties of crosslinked biomaterials fabricated from ELP variants. In general, substitutions in ELPs involving similiar domain types (hydrophobic or crosslinking) had little effect on mechanical properties. However, modifications altering either the structure or the characteristic sequence style of these domains had significant effects on such properties. In addition, using a series of deletion and replacement constructs for full‐length hTE, we provide new insights into the role of conserved domains of tropoelastin in determining mechanical properties. © 2012 Wiley Periodicals, Inc. Biopolymers 99: 392–407, 2013.