Studies on metabolic role of 5′-methylthioadenosine in Ochromonas malhamensis and other microorganisms

Several compounds containing a thiomethyl group were found to replace vitamin B₁₂ in a protozoan, Ochromonas malhamensis. The order of the effectiveness was as follows: 5-methylthioadenosine > S-adenosylmethionine > 5-methylthioribose > L-methionine. A similar order was obtained with respect to the permeability of these compounds into the protozoan cells, except for S-adenosylmethionine. 5-Methylthioadenosine and 5-methylthioribose as well as l-methionine markedly increased the intracellular content of l-methionine. The level of S-adenosylmethionine was also increased by them, but to a lesser degree. The thiomethyl group of the compounds was established to be incorporated into S-adenosylmethionine. The metabolic fate of the thiomethyl group of 5-methylthioadenosine cannot be distinguished from that of l-methionine. A high activity of 5-methylthioadenosine nucleosidase was detected in the cell-free extracts of the protozoan. These results strongly suggest that 5-methylthioadenosine would be metabolized to l-methionine via 5-methylthioribose and then the l-methionine would be converted to S-adenosylmethionine. Like l-methionine and vitamin B₁₂, 5-methylthioadenosine and 5-methylthioribose may play an important role in maintenance of the C-1 pool in Ochromonas malhamensis.Neither 5-methylthioadenosine nor 5-methylthioribose replaced vitamin B₁₂ in some vitamin B₁₂-requiring bacteria. This result is consistent with the fact that neither compounds was significantly taken up by these bacteria.Abbreviations MTA 5-methylthioadenosine - AdoMet S-adenosylmethionine - MTR 5-methylthioribose - TCA trichloroacetic acid Paper II in the series. The first paper of the series has been published (Sugimoto and Fukui, 1974)     

Freeze-etching studies on ultrastructural changes of endothelial cells in the thyroid of normal,TSH-treated and Thyradin-treated mice

Summary Freeze-etching images of the capillary endothelium in the thyroid of normal, TSH-treated and Thyradin (powdered thyroid)-treated mice were examined. Numerous pores represent vesicular stomata or fenestrations. The number of the pores and their population density are increased in TSH-treated mice, and decreased in Thyradin-treated animals. In addition, the width of the parajunctional zone and of the flat ray free from endothelial pores is smaller in TSH-treated mice and larger in Thyradin-treated animals. These facts indicate that the number of endothelial pores changes according to the functional activity of the gland.Supported by a grant from the Japanese Educational Ministry     

Immunogenicity of lysozyme derivatives lipid-conjugated to various degrees in mice treated with and without cyclophosphamide: dissociation of delayed-type hypersensitivity and helper function.

Lysozyme and a series of its lipid-conjugated derivatives without adjuvant were examined in mice for their abilities to induce delayed-type hypersensitivity (DTH), helper T-cell activity, and antibody formation. In addition, the effect of cyclophosphamide (CY) on the immune responses was assessed in mice immunized with these lysozyme derivatives. Precipitated lysozyme without lipid conjugation was a good inducer of both antibody and DTH responses. Lipid conjugation to lysozyme to intermediate degrees readily caused the failure only in inducing the antibody response. As lysozyme was lipid-conjugated more heavily, DTH response was also reduced and finally abolished. In contrast, the helper activity was little affected by any degree of lipid conjugation. These results indicate that the helper T-cell activity was dissociated from the both DTH response and the antibody production. CY pretreatment extensively enhanced DTH response induced by such lipid-conjugated derivatives that failed to induce antibody response. Furthermore, CY pretreatment in doses in a wide range enhanced not only DTH response but also antibody formation. It is, therefore, concluded that the enhancement of DTH response by CY does not necessarily entail suppression of antibody formation.     

Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').     

Experimental Approach Reveals the Role of alx1 in the Evolution of the Echinoderm Larval Skeleton

Over the course of evolution, the acquisition of novel structures has ultimately led to wide variation in morphology among extant multicellular organisms. Thus, the origins of genetic systems for new morphological structures are a subject of great interest in evolutionary biology. The larval skeleton is a novel structure acquired in some echinoderm lineages via the activation of the adult skeletogenic machinery. Previously, VEGF signaling was suggested to have played an important role in the acquisition of the larval skeleton. In the present study, we compared expression patterns of Alx genes among echinoderm classes to further explore the factors involved in the acquisition of a larval skeleton. We found that the alx1 gene, originally described as crucial for sea urchin skeletogenesis, may have also played an essential role in the evolution of the larval skeleton. Unlike those echinoderms that have a larval skeleton, we found that alx1 of starfish was barely expressed in early larvae that have no skeleton. When alx1 overexpression was induced via injection of alx1 mRNA into starfish eggs, the expression patterns of certain genes, including those possibly involved in skeletogenesis, were altered. This suggested that a portion of the skeletogenic program was induced solely by alx1. However, we observed no obvious external phenotype or skeleton. We concluded that alx1 was necessary but not sufficient for the acquisition of the larval skeleton, which, in fact, requires several genetic events. Based on these results, we discuss how the larval expression of alx1 contributed to the acquisition of the larval skeleton in the putative ancestral lineage of echinoderms.     

Lagenidium myophilum infection in the coonstripe shrimp,Pandalus hypsinotus

A fungal infection occurred in juvenile coonstripe shrimps,Pandalus hypsinotus, cultured at Hokkaido Institute of Mariculture, Hokkaido, Japan. The fungus was identified asLagenidium myophilum, the same fungus that had previously been isolated from the abdominal muscle of adult northern shrimps,Pandalus borealis, and larvae of the coonstripe shrimp. Histopathologically, numerous nonseptate hyphae were observed in the lesions, and melanized hemocytes were present within the blackened areas. The optimum temperature for growth of the present strain was 25–30°C, and the optimum NaCl concentration for growth was 0.5–1.0%. Its biological characteristics were compared with those ofLagenidium myophilum isolated from diseased larval coonstripe shrimp and adult northern shrimp. The fungus was pathogenic toward shrimps of the genusPandalus, which live in deep sea areas. The fungus could infect shrimps at various stages, from larva to adult.     

Influence of surface anesthesia on the pressure pain threshold measured with different-sized probes

Transcutaneous pressure with pressure probes of arbitrary diameters have been commonly used for measuring the threshold and magnitude of muscle pain, yet this procedure lacks scientific validation. To examine the valid probe dimensions, we conducted physiological experiments using 34 human subjects. Pin-prick pain, pressure pain threshold (PPT) to pressure probes of various diameters, heat pain threshold, and electrical pain threshold of deep tissues were measured before and after application of surface lidocaine anesthesia to the skin surface over the brachioradial muscle in a double-blinded manner. The anesthesia neither affected PPT with larger probes (diameters: 1.6 and 15?mm) nor increased electric pain threshold of deep structures, whereas it diminished pain count in pin-prick test and PPT with a 1.0?mm diameter probe, suggesting that mechanical pain thresholds measured with 1.6 and 15?mm probes reflect the pain threshold of deep tissues, possibly muscle. Pain thresholds to heat did not change after application of the anesthesia. These results suggest that larger pressure probes can give a better estimation of muscular pain threshold.     

Magnesium ion: a possible physiological regulator of aldosterone production

We examined the direct effect of magnesium ion on aldosterone production by adrenal cells using collagenase-dispersed zona-glomerulosa cells in rats. The effects of magnesium on aldosterone production stimulated by angiotensin II or ACTH were also investigated. Both magnesium sulphate (MgSO4) and magnesium chloride (MgCl2) (0 to 2 mM) decreased aldosterone production in a dose-dependent manner. In comparison with magnesium-free medium, 2 mM MgSO4 inhibited aldosterone production by 73% and MgCl2 by 65%. In addition, MgSO4 showed an inhibitory effect on aldosterone production stimulated by angiotensin II (10pM to 10nM), whereas it had no significant effect on aldosterone production due to ACTH stimulation (10pM to 10nM). These data suggest that magnesium has an inhibitory action on aldosterone production in vitro and may be a physiological regulator of aldosterone production.