Augmentation of lenvatinib efficacy by topical treatment of miR-634 ointment in anaplastic thyroid cancer

Anaplastic thyroid cancer (ATC) is one of the most lethal types of human tumors. Lenvatinib can improve the disease control and prognosis in patients with ATC. However, there is an unmet need to develop a therapeutically safer and non-invasive strategy that improves the efficacy of lenvatinib for advanced ATC tumors, which grow larger close to the skin. We previously demonstrated that the topical application of an ointment incorporating tumor suppressive microRNA (TS-miR), miR-634, is a useful strategy as a TS-miR therapeutics. Here, we found that the overexpression of miR-634 synergistically increased lenvatinib-induced cytotoxicity by concurrently downregulating multiple genes related to cytoprotective processes, including ASCT2, a glutamine transporter, in ATC cell lines. Furthermore, the topical application of a miR-634 ointment on subcutaneous tumors effectively augmented the anti-tumor effects of lenvatinib in an ATC xenograft mouse model. Thus, we propose topical treatment of a miR-634 ointment as a rational strategy for improving lenvatinib-based therapy for ATC.     

Restriction Enzyme-Resistant High Molecular Weight Telomeric DNA Fragments in Tobacco

Restriction endonuclease-resistant high-molecular-weight (HMW)DNA fragments were isolated from nuclear DNA fragments in tobacco.The size of the fragments produced by EcoRI, HindIII, AfaI,and HaeIII ranged from 20 kb to over 166 kb. The kinetics ofdigestion by Bal31 nuclease showed that most of the HMW fragmentsare chromosome ends. The consensus sequence for tobacco telomererepeats was determined to be CCCTAAA by genomic sequencing usingthe HMW fragments and by sequencing after cloning. Besides thetelomere sequence, 9 tandem repeats of a 45-bp sequence wereidentified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT)formed a stem structure. The front of the stem is composed ofa palindrome of the telomere repeats. This highly conservedunit is surrounded by less conserved internal sequences thatare around 10–11 bp in size and contain a TTTT stretch.The internal sequences resemble the 10–11 bp consensusfor the scaffold attachment regions found in yeast and drosophila.The characteristic 45-bp sequence was abundant on the ends ofchromosomes. The shortest distance between the repeats containingtelomeric stem and the telomere was less than 20 kb. This architectureof the tobacco chromosome end region resembles the end regionof yeast chromosomes in which autonomous replication sequencesare present frequently.     

Modeling and optimization of alpha-amylase production in a recombinant yeast fed-batch culture taking account of the cell cycle population distribution.

A simple mathematical model describing the cell cycle dependency of rice alpha-amylase production by a recombinant yeast was constructed to investigate the efficiency of cell cycle population control. First, the effects of the glucose concentration and cultivation temperature on the specific growth rate, the specific production rate of rice alpha-amylase, and the distribution of the cell cycle population were studied under balanced growth conditions. On the basis of the results, parameter values for the mathematical model were then estimated. The proposed model was shown to be applicable for unbalanced as well as balanced growth phases. The optimal control strategy in respect of temperature and glucose concentration for maximum rice alpha-amylase production, taking into account the cell cycle population, was determined and the result was compared with that obtained by a simple mathematical model in which cell cycle distribution was not considered. Finally, the effect of the initial population of each cell cycle phase on the final amount of the product under optimal operational conditions was investigated. The simulation and experimental data coincided well with each other, and the model was used to optimize the control strategy for maximum alpha-amylase production.     

Inter-annual variation in the response of leaf-out onset to soil moisture increase in a teak plantation in northern Thailand

To understand the impact of inter-annual climate change on vegetation-atmosphere mass and energy exchanges, it has become necessary to explore changes in leaf-out onset in response to climatic fluctuations. We examined the response of leaf-out and transpiration onset dates to soil moisture in a teak plantation in northern Thailand based on a 12-year leaf area index and sap flow measurements. The date of leaf-out and transpiration onset varied between years by up to 40 days, and depended on the initial date when the relative extractable water in a soil layer of 0–0.6 m (Θ) was greater than 0.2 being consistent with our previous results. Our new finding is that the delay in leaf-out and transpiration onset relative to the initial date when Θ?>?0.2 increases linearly as the initial date on which Θ?>?0.2 becomes earlier. The delay spans about 20 days in years when Θ?>?0.2 occurs in March (the late dry season)—much earlier than usual because of heavy pre-monsoon rainfalls—while there is little delay in years when Θ?>?0.2 occurs in May. This delay indicates the influence of additional factors on leaf-out onset, which controls the delay in the response of leaf-out to soil moisture increase. The results increased our knowledge about the pattern and extent of the changes in leaf phenology that occur in response to the inter-annual climate variation in tropical regions, where, in particular, such research is needed.     

Release of Carbonic Anhydrase from the Cell Surface of Chlamydomonas reinhardtii by Trypsin

Treatment with trypsin of Chlamydomonas reinhardtii cells grownin ordinary air (low-CO₂ cells) caused almost complete releaseof carbonic anhydrase (CA) into the suspending medium, but didnot affect the shape and kinesis of the cells. These resultsindicate that most of the CA exists on the cell surface of low-CO₂cells. The released CA has the same molecular weight, specificactivity and susceptibility to various CA inhibitors as thatpurified from non-treated low-CO₂ cells. (Received August 24, 1985; Accepted November 20, 1985)     

Sequence Analysis of the groESL-cotA Region of the Bacillus subtilis Genome, Containing the Restriction/Modification System Genes

We have determined a 35-kb sequence of the groESL-gutR-cotA(45°–52°) region of the Bacillus subtilis genome.In addition to the groESL, gutRB and cotA genes reported previously,we have newly identified 24 ORFs including gutA and fruC genes,encoding glucitol permease and fructokinase, respectively. Theinherent restriction/modification system genes, hsdMR and hsdMM,were mapped between groESL and gutRB, and we have identifiedtwo open reading frames (ORFs) encoding 5-methylcytosine formingDNA methyl transferase and an operon probably encoding a restrictionenzyme complex. The unusual genome structure of few ORFs andlower GC content around the restriction/modification genes stronglysuggests that the region originated from a bacteriophage integratedduring evolution.