Restriction Enzyme-Resistant High Molecular Weight Telomeric DNA Fragments in Tobacco

Restriction endonuclease-resistant high-molecular-weight (HMW)DNA fragments were isolated from nuclear DNA fragments in tobacco.The size of the fragments produced by EcoRI, HindIII, AfaI,and HaeIII ranged from 20 kb to over 166 kb. The kinetics ofdigestion by Bal31 nuclease showed that most of the HMW fragmentsare chromosome ends. The consensus sequence for tobacco telomererepeats was determined to be CCCTAAA by genomic sequencing usingthe HMW fragments and by sequencing after cloning. Besides thetelomere sequence, 9 tandem repeats of a 45-bp sequence wereidentified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT)formed a stem structure. The front of the stem is composed ofa palindrome of the telomere repeats. This highly conservedunit is surrounded by less conserved internal sequences thatare around 10–11 bp in size and contain a TTTT stretch.The internal sequences resemble the 10–11 bp consensusfor the scaffold attachment regions found in yeast and drosophila.The characteristic 45-bp sequence was abundant on the ends ofchromosomes. The shortest distance between the repeats containingtelomeric stem and the telomere was less than 20 kb. This architectureof the tobacco chromosome end region resembles the end regionof yeast chromosomes in which autonomous replication sequencesare present frequently.     

Dealkylation rates of O6-alkyldeoxyguanosine, O4-alkylthymidine and related compounds in an alkyl-transfer system

Bacterial O6-alkylguanine-DNA alkyltransferase (AGT) removes alkyl group from O6-alkylguanine and O4-alkylthymine residues in DNA, both of which are considered to be DNA damages most related to the induction of cancer and/or mutation. The repair process involves alkyl-transfer of an O-alkyl group to the active site of the enzyme, where an SH-group of cysteine residue plays the role of alkyl acceptor. In order to elucidate the chemical characteristics of substrates for this enzyme, dealkylation rates of O6-alkyldeoxyguanosine, O4-alkylthymidine and related compounds were measured using an alkyl-transfer system. Thiophenol-triethylamine system was employed as an alkyl acceptor and twenty-one O-alkyl compounds were tested. Dealkylation proceeded with pseudo first order kinetics. The half-life of O6-methyldeoxyguanosine (MedG) was 122 h and no remarkable dependence on N-9 substituents (H, CH3 and deoxyribose) was observed. A compound lacking 2-NH2 group underwent demethylation about three times faster than O6-methylguanines did, while, a compound lacking imidazole moiety underwent demethylation about 2.5 times more slowly. The half-life of O4-methylthymidine (MedT) was 38 h and no remarkable dependence on N-1 (H, CH3 and deoxyribose) and C-5 (H and CH3) substituents was observed. Deethylation proceeded much more slowly than demethylation. Substitution of selenophenol for thiophenol resulted in a 4.5 times faster MedG demethylation rate. Demethylation rates were moderately correlated with values for NMR chemical shift of CH3 group, an indicator of electron density, although the correlation curves of a series of MedG and MedT derivatives were quite different. This result suggests that some different rate-determining factors other than electron density are playing a role. These findings may be of help in resolving the details of the mechanisms of enzymic repair by bacterial and mammalian AGT.     

Detection of PIVKA II produced by human hepatoma cells in nude mice.

A novel experimental nude mouse model, which is useful for investigation of the mechanisms of PIVKA II synthesis, was established by inoculation with PIVKA II-producing human hepatoma cells (huH-1). We have found markedly elevated levels of PIVKA II in the plasma of nude mice transplanted with huH-1 cells and increased PIVKA II content in huH-1 tumor tissues. Whereas we have not found detectable level of PIVKA II neither in the plasma nor in tumor tissues of nude mice transplanted different human hepatoma cells (HLF) which is not producing PIVKA II. Histology of the tumor tissues produced by huH-1 cells revealed a thick trabecular pattern with blood spaces.     

Release of Carbonic Anhydrase from the Cell Surface of Chlamydomonas reinhardtii by Trypsin

Treatment with trypsin of Chlamydomonas reinhardtii cells grownin ordinary air (low-CO₂ cells) caused almost complete releaseof carbonic anhydrase (CA) into the suspending medium, but didnot affect the shape and kinesis of the cells. These resultsindicate that most of the CA exists on the cell surface of low-CO₂cells. The released CA has the same molecular weight, specificactivity and susceptibility to various CA inhibitors as thatpurified from non-treated low-CO₂ cells. (Received August 24, 1985; Accepted November 20, 1985)     

Stalled replication forks: Making ends meet for recognition and stabilization

In bacteria, PriA protein, a conserved DEXH‐type DNA helicase, plays a central role in replication restart at stalled replication forks. Its unique DNA‐binding property allows it to recognize and stabilize stalled forks and the structures derived from them. Cells must cope with fork stalls caused by various replication stresses to complete replication of the entire genome. Failure of the stalled fork stabilization process and eventual restart could lead to various forms of genomic instability. The low viability of priA null cells indicates a frequent occurrence of fork stall during normal growth that needs to be properly processed. PriA specifically recognizes the 3′‐terminus of the nascent leading strand or the invading strand in a displacement (D)‐loop by the three‐prime terminus binding pocket (TT‐pocket) present in its unique DNA binding domain. Elucidation of the structural basis for recognition of arrested forks by PriA should provide useful insight into how stalled forks are recognized in eukaryotes.     

Sequence Analysis of the groESL-cotA Region of the Bacillus subtilis Genome, Containing the Restriction/Modification System Genes

We have determined a 35-kb sequence of the groESL-gutR-cotA(45°–52°) region of the Bacillus subtilis genome.In addition to the groESL, gutRB and cotA genes reported previously,we have newly identified 24 ORFs including gutA and fruC genes,encoding glucitol permease and fructokinase, respectively. Theinherent restriction/modification system genes, hsdMR and hsdMM,were mapped between groESL and gutRB, and we have identifiedtwo open reading frames (ORFs) encoding 5-methylcytosine formingDNA methyl transferase and an operon probably encoding a restrictionenzyme complex. The unusual genome structure of few ORFs andlower GC content around the restriction/modification genes stronglysuggests that the region originated from a bacteriophage integratedduring evolution.