A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

The flagellar root apparatus,the microtubular system and associated organelles in the chrysophycean flagellate,Poterioochromonas malhamensis Peterfi (syn.Poteriochromonas stipitata Scherffel andOchromonas malhamensis pringsheim)

Summary The two flagella ofPoterioochromonas are inserted in an apical platform which is shaped by six long flagellar root fibres. The arrangement and structure of these root fibres are described in detail. One of these fibres is the single nucleating site for cytoplasmic interphase microtubules which extend peripherally down to the cytoplasmic tail. Another fibre proceeds toward the centre of the cell and passes the nucleus but is different in structure, position and function from the striated rhizoplast found in many chrysophycean flagellates which is observed but vestigial inPoterioochromonas.A specific kinetosomal mitochondrion has a threefold attachment to the flagellar root apparatus. The chloroplast is also bound to the root system. It has no stigma, but a special continuation of the periplastidial cisterna is developed instead. Another cisterna extends from the nuclear envelope-dictyosome interspace to the kinetosome of the long flagellum. The functional and taxonomic meanings of these structures and of their mutual arrangement are discussed. It is concluded that the present strain (no. 933-1 a of the Collection of Algal Cultures at the Institute of Plant Physiology, Göttingen) has to be excluded from the genusOchromonas.     

Lack of effect on the chromosomal non-disjunction in aged female mice after low dose X-irradiation.

Karyotypes were determined in 1064 embryos of aged C57/BL mothers. The virgin female mice were irradiated with 0, 4, 8 or 16 R of X-rays, respectively, and placed with young untreated males 5 days after irradiation. 10.5-days old embryos were recovered from the uterus. Aneuploid embryos classified as alive (heart beats observed at the dissection) were 1 monosomic in the control group (496 embryos) and 2 trisomics in the irradiated group (568 embryos). The number of aneuploid embryos classified as dead was 4 trisomic cases in the control group and 3 trisomics in the irradiated group. The data indicate that trisomic embryos are not uncommon in the mouse but are eliminated in post-implantation death. In contrast to the results of Yamamoto et al. the present data do not demonstrate an increased frequency of chromosome abnormalities in embryos of aged mice X-irradiated before mating as compared to non-irradiated ones.     

Argyrophil endocrine cells with ACTH and HCG immunoreactivity in a carcinoma of the breast

A middle-aged woman without any symptoms of ectopic hormone production underwent a right-sided mastectomy for infiltrating ductal carcinoma. She later developed axillary lymph node metastases which were somewhat carcinoid-like. This prompted further investigation, when scattered argyrophilic endocrine cells were found in both the primary tumour and its metastases. The endocrine cells reacted immunocytochemically with antisera against ACTH and HCG. Despite the endocrine activity of the tumour, it was still regarded as a ductal carcinoma since the endocrine cells constituted the minority cell population. The present study indicates strongly that ectopic hormone production in association with carcinoma of the breast is a result of hormone synthesis and release by the tumour cells.