Membrane-trafficking RabA4c involved in the effect of glycine betaine on recovery from chilling stress in Arabidopsis

Glycine betaine (GB) can confer tolerance to several types of stress at low concentrations, either after application to plants or in transgenics engineered to overproduce GB. Based on earlier studies on levels of GB in plants and evidence for effects on gene expression, we hypothesized that at least part of this effect could be ascribed to the activation of the expression of stress tolerance genes. Using a strategy based on high-throughput gene expression analysis with microarrays followed by confirmation with northern blots, we identified Arabidopsis genes upregulated in roots that reinforce intracellular processes protecting cells from oxidative damage and others that appear to be involved in reinforcing a scavenging system for reactive oxygen species (ROS) in cell walls. Upregulated genes in roots include those for the membrane-trafficking RabA4c, the root-specific NADPH-dependent ferric reductase (FRO2) localized to the plasma membrane, mitochondrial catalase 2 and the cell wall peroxidase ATP3a. Comparative studies with wild-type Arabidopsis and knockout mutants for the membrane-trafficking RabA4c gene demonstrated that the mutants respond only slightly to GB, if at all, compared with wild-type in relation to root growth recovery after chilling stress, demonstrating the role of RabA4c in relation to the GB effect. The results point toward links between oxidative stress, gene expression, membrane trafficking and scavenging of ROS such as superoxide and hydrogen peroxide in relation to GB effects on chilling tolerance in plants.     

Location of crosslinks in chemically stabilized horseradish peroxidase: implications for design of crosslinks.

The bifunctional compound, ethylene-glycol bis(N-hydroxysuccinimidylsuccinate) (EGNHS), stabilizes horseradish peroxidase C (HRP) by reaction with the enzyme's lysine residues. In this study we compare native and modified HRP by proteolytic fragmentation, peptide sequencing, and mass spectroscopy, and identify the sites of modification. Most significantly, EGNHS is shown to form a crosslink between Lys232 and Lys241 of HRP and modifies Lys174 without formation of a crosslink. These findings are in agreement with the lysine side-chain reactivities predicted from the surface accessibility of the amino groups, and the maximal span of 16 A of the EGNHS crosslinker.     

Stressful life events preceding the acute onset of schizophrenia: A cross-national study from the World Health Organization

This study reports on the findings from a WHO sponsored cross-national investigation of life events and schizophrenia. Data are presented from a series of 386 acutely ill schizophrenic patients selected from nine field research centers located in developing and developed countries (Aarhus, Denmark; Agra, India; Cali, Colombia; Chandigarh, India; Honolulu, USA; Ibadan, Nigeria; Nagasaki, Japan; Prague, Czechoslovakia; Rochester, USA). On a methodological level, the study demonstrates that life event methodologies originating in the developed countries can be adapted for international studies and may be used to collect reasonably reliable and comparable cross-cultural data on psychosocial factors affecting the course of schizophrenic disorders. Substantive findings replicate the results of prior studies which conclude that socioenvironmental stressors may precipitate schizophrenic attacks and such events tend to cluster in the two to three week period immediately preceding illness onset.The paper was prepared by these authors on behalf of the collaborating investigators listed on page 196.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Structure and immunochemistry of an oligosaccharide repeating unit of the capsular polysaccharide of type III group B Streptococcus. A revised structure for the type III group B streptococcal polysaccharide antigen

We have derived oligosaccharides from the capsular polysaccharide of type III group B Streptococcus by enzymatic hydrolysis of a specific backbone glycosidic bond utilizing an endo-beta-galactosidase from Flavobacterium keratolyticus. Enzymatic digestion of the polysaccharide produced oligosaccharide fragments of one or more pentasaccharide repeating units. On the basis of 13C NMR, 1H NMR, and methylation analyses, it was established that the smallest digestion fragment was alpha-D-NeupNAc-(2----3)-beta-D-Galp-(1----4)-[beta-D-Glcp-(1----6 )]- beta-D-GlcpNAc-(1----3)-beta-D-Gal. The isolation of this oligosaccharide is consistent with the susceptibility of the beta-D-Galp-(1----4)-beta-D-Glcp linkage in the backbone of the type III group B streptococcal polysaccharide and confirms that the polysaccharide is composed of a pentasaccharide repeating unit. High resolution 13C NMR spectroscopic studies indicated that, as in the case of the pentasaccharide, the terminal sialic acid residues of the type III group B streptococcal polysaccharide were linked to O-3 and not to O-6 of its branch beta-D-galactopyranosyl residues as had been previously reported (Jennings, H. J., Rosell, K.-G., and Kasper, D. L. (1980) Can. J. Chem. 58, 112-120). This linkage was confirmed in an independent methylation analysis of the type III group B streptococcal polysaccharide. Thin layer chromatogram binding assay and radioactive antigen binding assays with radiolabeled oligosaccharides demonstrated the single repeating unit pentasaccharide oligosaccharide to be poorly antigenic. Increasing oligosaccharide size to a decasaccharide consisting of two repeating units resulted in an 8-fold increase in antigen binding in the direct radioactive antigen binding assay. The results suggest that a region of the immunodeterminant site critical for antibody binding is located in the backbone of the polysaccharide and involves the beta-D-galactopyranose-(1----4) beta-D-glucopyranose bond.