The Outcome of Health Anxiety in Primary Care. A Two-Year Follow-up Study on Health Care Costs and Self-Rated Health

Background

Hypochondriasis is prevalent in primary care, but the diagnosis is hampered by its stigmatizing label and lack of valid diagnostic criteria. Recently, new empirically established criteria for Health anxiety were introduced. Little is known about Health anxiety''s impact on longitudinal outcome, and this study aimed to examine impact on self-rated health and health care costs.

Methodology/Principal Findings

1785 consecutive primary care patients aged 18–65 consulting their family physicians (FPs) for a new illness were followed-up for two years. A stratified subsample of 701 patients was assessed by the Schedules for Clinical Assessment in Neuropsychiatry interview. Patients with mild (N = 21) and severe Health anxiety (N = 81) and Hypochondriasis according to the DSM-IV (N = 59) were compared with a comparison group of patients who had a well-defined medical condition according to their FPs and a low score on the screening questionnaire (N = 968). Self-rated health was measured by questionnaire at index and at three, 12, and 24 months, and health care use was extracted from patient registers. Compared with the 968 patients with well-defined medical conditions, the 81 severe Health anxiety patients and the 59 DSM-IV Hypochondriasis patients continued during follow-up to manifest significantly more Health anxiety (Whiteley-7 scale). They also continued to have significantly worse self-rated functioning related to physical and mental health (component scores of the SF-36). The severe Health anxiety patients used about 41–78% more health care per year in total, both during the 3 years preceding inclusion and during follow-up, whereas the DSM-IV Hypochondriasis patients did not have statistically significantly higher total use. A poor outcome of Health anxiety was not explained by comorbid depression, anxiety disorder or well-defined medical condition. Patients with mild Health anxiety did not have a worse outcome on physical health and incurred significantly less health care costs than the group of patients with a well-defined medical condition.

Conclusions/Significance

Severe Health anxiety was found to be a disturbing and persistent condition. It is costly for the health care system and must be taken seriously, i.e. diagnosed and treated. This study supports the validity of recently introduced new criteria for Health anxiety.     

Galanin in pituitary adenomas

Tumor galanin content was measured in extracts from human pituitary adenomas using a specific RIA method for monitoring human galanin. Twenty-two out of twenty-four tumors contained galanin with notably high levels in corticotroph adenomas, varying levels in clinically inactive tumors, and low levels in GH secreting adenomas. Tumor galanin and ACTH contents were closely correlated in all tumors. In four young patients with microadenomas and highly active Mb Cushing tumor galanin was inversely related to tumor volume. The molecular form of tumor galanin, studied with reverse-phase HPLC, was homogeneous with the majority of tumor galanin coeluting with standard human galanin. In the tumors analysed with in situ hybridization there was a good correlation between galanin peptide levels and galanin mRNA expression. In some tumors galanin mRNA and POMC levels coexisted, in others they were essentially in different cell populations. Levels of plasma galanin-LI were not related to tumor galanin concentration, and galanin levels were in the same range in sinus petrosus close to the pituitary venous drainage as in peripheral blood. Corticotrophin releasing hormone injections in two patients caused ACTH, but no detectable galanin release into sinus petrosus. Our results demonstrate that corticotroph, but not GH adenomas, express high levels of galanin, in addition to ACTH, and that in some tumors both polypeptides are synthesised in the same cell population. However, galanin levels in plasma were not influenced by the tumor galanin content.     

Beta-amyloid (Abeta) protein in cerebrospinal fluid as a biomarker for Alzheimer's disease

With the arrival of symptomatic treatment (acetylcholine esterase inhibitors) and the promise of drugs that may delay disease progression, development of diagnostic biomarkers for Alzheimer's disease (AD) are important. Beta-Amyloid (Abeta) protein is the main component of senile plaques. A marked reduction in cerebrospinal fluid (CSF)-Abeta42 in AD has been found in numerous studies. Importantly, reduced CSF-Abeta42 is also found very early in the disease process, before the onset of clinical symptoms. Recent studies suggest that CSF-Abeta42 have a satisfactory performance when used as a diagnostic marker for AD in clinical routine. This paper reviews CSF-Abeta42 as a biomarker for AD.     

PATTERNS OF MACROALGAL SPECIES DIVERSITY IN DANISH ESTUARIES

We analyzed species number of macroalgae in relation to environmental variables at two spatial levels comprising 202 individual sites and 26 entire estuaries in Denmark. The species number of macroalgae increased with salinity and declined with nutrient concentrations both at the sites and in the estuaries. Availability of hard substratum was associated with higher species richness at the sites. The number of macroalgal species in the estuaries increased with higher mean depth and longer coastline, suggesting that both the vertical and horizontal extension of the colonization area are important for the maximum representation of macroalgal species. Mean depth explained as a single predictor 60% of the variability in species number in entire estuaries. Estuaries with high mean depth also tend to be large and have high salinity and transparent waters due to efficient exchange with open waters. In conclusion, we find that the regulation of species richness of macroalgae in Danish estuaries, though complex, is influenced predictably by salinity, water transparency, nutrient concentration, and availability of hard substrata.     

HETEROTROPHIC GROWTH OF ULVA LACTUCA (CHLOROPHYCEAE)1

The effect of external glucose (51 mM) and acetate (13 mM) on growth and photosynthetic capacity of Ulva lactuca L. was tested in laboratory cultures over 41 days in the dark and in dim light (0.9 μmol photons·m^?2·s^?1) at 7–8° C. Glucose and acetate had a significant positive effect on growth rate, chlorophyll content, and quantum yield for discs grown in the dark and in dim light. The carbon gain from heterotrophic uptake was low and only allowed U. lactuca to maintain a specific uptake was low and only allowed U. lactuca to maintain a specific growth rate of 0.005 day^?1 compared to 0.06–0.1 day^?1 at higher light intensities. However, plants with added organic substrate maintained a normal chlorophyll content and were able to photosynthesize whereas control plants lost pigmentation and photosynthetic capability after 41 days in both dim light and darkness, probably because of disorganization of the photosynthetic apparatus. This suggest that the ecological significance of heterotrophic uptake is to allow U. lactuca to survive during prolonged low light conditions with an intact photosynthetic apparatus.     

The rates of macromolecular chain elongation modulate the initiation frequencies for transcription and translation inEscherichia coli

Here we show that most macromolecular biosynthesis reactions in growing bacteria are sub-saturated with substrate. The experiments should in part test predictions from a previously proposed model (Jensen & Pedersen 1990) which proposed a central role for the rates of the RNA and peptide chain elongation reactions in determining the concentration of initiation competent RNA polymerases and ribosomes and thereby the initiation frequencies for these reactions. We have shown that synthesis of ribosomal RNA and the concentration of ppGpp did not exhibit the normal inverse correlation under balanced growth conditions in batch cultures when the RNA chain elongation rate was limited by substrate supply. The RNA chain elongation rate for the polymerase transcribinglacZ mRNA was directly measured and found to be reduced by two-fold under conditions of high ppGpp levels. In the case of translation, we have shown that the peptide elongation rate varied at different types of codons and even among codons read by the same tRNA species. The faster translated codons probably have the highest cognate tRNA concentration and the highest affinity to the tRNA. Thus, the ribosome may operate close to saturation at some codons and be unsaturated at synonymous codons. Therefore, not only translation of the codons for the seven amino acids, whose biosynthesis is regulated by attenuation, but also a substantial fraction of the other translation reactions may be unsaturated. Recently, we have obtained results which indicate that also many ribosome binding sites are unsaturated with their substrate, i.e. with ribosomes. This observation affects the interpretation of many results obtained by use of reporter genes, because the expression from such genes is strongly influenced by the general physiology of the cell.     

The nucleotide sequence for the replication region of pVS40, a lactococcal food grade cloning vector

The replication region of a limited host range lactococcal vector, pVS40, was located within a 2359 bp Eco RI- Cla I fragment. Within this fragment a sequence for a 1197 bp reading frame coding for a 46 826 Da protein together with a putative ribosomal binding site and the -10 and -35 promoter regions could be detected. Immediately upstream from the promoter were three complete and one nearly complete successive direct repeats (TATAGCGTATGAAAAAACTGTG), suggesting an origin of replication. The protein has considerable homologies to certain lactococcal plasmid replication proteins.     

Growth and energetics of a trichopteran larva feeding on fresh submerged and terrestrial plants

We studied the growth and assimilation of larvae of Anabolia nervosa, a lotic trichopteran shredder, on diets of fresh tissue of the submerged macrophyte Potamogeton perfoliatus and fresh leaves of the trees Alnus glutinosa and Fagus sylvatica. Fifth-instar larvae were fed these three diets for 23 days (20 May–12 June) in the laboratory. Instantaneous growth rate and gross growth efficiency were almost the same for larvae fed Potamogeton and Alnus, but lower for larvae fed Fagus. The larvae consumed 3 times more fresh Potamogeton than Alnus leaves, but the same amounts in terms of dry mass. The consumption of fresh Fagus was initially twice that of the two other food items but dropped rapidly during the experiment, following the marked seasonal decline of leaf nitrogen content. Allocation patterns of fat and protein differed among food sources. Larvae grown on Alnus accumulated more fat than larvae grown on Potamogeton, while the reverse was true for protein accumulation. The assimilation efficiency based on carbon units was the same (44%) for all three food items and was among the highest reported for shredding caddis larvae. The study demonstrates that fresh tissue of Potamogeton perfoliatus provides a valuable food source to the facultative shredder herbivore Anabolia nervosa.     

Phytoplankton and Epiphyte Development and Their Shading Effect on Submerged Macrophytes in Lakes of Different Nutrient Status

The annual mean light intensity at the depth limit of the Littorella vegetation was 24–33% of the subsurface light intensity, despite large variations in each attenuation component (lake water, phytoplankton, and epiphytes). In oligotrophic, silicate-poor lakes, the light attenuation above the submerged vegetation was dominated by the water itself, which accounted for 65–72% of the total attenuation. Phytoplankton and epiphytes were equal in importance to each other. In oligotrophic, silicate-rich lakes and lakes receiving a nitrogen supply above background level, the epiphytes were more abundant, accounting for about 50% of the light attenuation. In one lake with a high nutrient supply, the epiphytes were responsible for 86% of the light attenuation. A new method of measuring the effect of shading by the epiphytic community on submerged macrophytes is presented. The light attenuation caused by the phytoplankton and the epiphytes was investigated and related to the depth distribution of the submerged angiosperm, Littorella uniflora. It is shown that the biomass of the epiphytes increased more than the biomass of the phytoplankton in response to an external or internal nutrient loading. Shading by epiphytes is of decisive importance for the depth distribution of Littorella at increasing nutrient supply.