GPR40 gene expression in human pancreas and insulinoma

To assess gene expression of a membrane-bound G-protein-coupled fatty acid receptor, GPR40, in the human pancreas and islet cell tumors obtained at surgery were analyzed. The mRNA level of the GPR40 gene in isolated pancreatic islets was approximately 20-fold higher than that in the pancreas, and the level was comparable to or rather higher than that of the sulfonylurea receptor 1 gene, which is known to be expressed abundantly in human pancreatic beta cells. A large amount of GPR40 mRNA was detected in tissue extracts from two cases of insulinoma, whereas the expression was undetectable in glucagonoma or gastrinoma. The present study demonstrates that GPR40 mRNA is expressed predominantly in pancreatic islets in humans and that GPR40 mRNA is expressed solely in human insulinoma among islet cell tumors. These results indicate that GPR40 is probably expressed in pancreatic beta cells in the human pancreas.     

Stabilization due to dimer formation of phosphoribosyl anthranilate isomerase from Thermus thermophilus HB8: X-ray Analysis and DSC experiments

The crystal structure of phosphoribosyl anthranilate isomerase (PRAI) from Thermus thermophilus HB8 (TtPRAI) was solved at 2.0 A resolution. The overall structure of TtPRAI with a dimeric structure was quite similar to that of PRAI from Thermotoga maritima (TmPRAI). In order to elucidate the stabilization mechanism of TtPRAI, its physicochemical properties were examined using DSC, CD, and analytical centrifugation at various pHs in relation to the association-dissociation of the subunits. Based on the experimental results for TtPRAI and the structural information on TtPRAI and TmPRAI, we found that: (i) the denaturation of TtPRAI at acidic pH is correlated with the dissociation of its dimeric form; (ii) the hydrophobic interaction of TtPRAI in the monomer structure is slightly greater than that of TmPRAI, but dimer interface of the TmPRAI is remarkably greater; (iii) the contributions of hydrogen bonds and ion bonds to the stability are similar to each other; and (iv) destabilization due to the presence of cavities in TtPRAI is greater than that of TmPRAI in both the monomer and dimer structures.     

Effects of soluble laminin on organelle transport and neurite growth in cultured mouse dorsal root ganglion neurons: difference between primary neurites and branches

Laminin, an extracellular matrix molecule, is known to promote neurite growth. In the present study, the effects of soluble laminin on organelle transport and their relation to neurite growth were investigated in cultured dissociated mouse dorsal root ganglion (DRG) neurons. Laminin added into the extracellular medium was deposited on the surface of DRG neurons. DRG neurons incubated with soluble laminin exhibited branched, long, and thin neurites. Time-lapse study demonstrated that many small-diameter branches were newly formed after the addition of laminin. Thus, the growths of large-diameter primary neuritis, arising from cell bodies and branches extended from growth cones of primary neuritis, were analyzed separately. Laminin decreased the growth rate of primary neurites but increased that of branches. In primary neurites, acute addition of laminin rapidly decreased organelle movement in the neurite shaft and growth cone, accompanied by slowing of the growth cone advance. Branching of primary neurites occurred in response to laminin in some growth cones. In these growth cones, organelles protruded into nascent branches. In branches, soluble laminin increased organelle movement in the growth cone and the distal portion of the shaft. These results suggest that laminin inhibits the elongation of primary neurites but promotes branching and elongation of branches, all of which seem to be closely related to organelle transport.     

Prominent immunogenicity of monosialosyl galactosylgloboside, carrying a stage-specific embryonic antigen-4 (SSEA-4) epitope in the ACHN human renal tubular cell line—a simple method for producing monoclonal antibodies against detergent-insoluble microdomains/raft

The binding of Shiga toxin (Stx) to Gb3Cer in detergent-insoluble microdomains (DIM)/raft of the ACHN human renal tubular cell line causes the temporal activation of the Src-family kinase Yes [1]. As a strategy for examining signaling mechanisms in DIM/raft, monoclonal antibodies (MAbs) are reliable tools for characterizing the constituent molecules in these microdomains. Thus, we employed DIM/raft suspensions of ACHN cells as an immunogen to develop MAbs. Simply subcutaneous injections of ACHN DIM/raft could elevate the serum titer after several boosts. The first screening was performed using dot-blot immunostaining with culture supernatants on a polyvinylidene difluoride (PVDF) membrane, on which DIM/raft or their chloroform/methanol (C/M) (2:1, v/v) extracts were dot-blotted. The next screening was performed by flowcytometric analysis of ACHN cells treated with or without a permeabilizing reagent. Many of the clones (21/31 clones=68%) thus obtained were also found to recognize to lipid fractions of the DIM/raft. Strikingly, all of the 21 clones that reacted to the lipid fraction were found to recognize monosialosyl galactosylgloboside (MSGG) or GL7, which carries the SSEA-4 epitope. Using DIM/raft as immunogens may enable us to easily obtain MAbs for glycolipids.     

A Spiking Neural Network Model of Model-Free Reinforcement Learning with High-Dimensional Sensory Input and Perceptual Ambiguity

A theoretical framework of reinforcement learning plays an important role in understanding action selection in animals. Spiking neural networks provide a theoretically grounded means to test computational hypotheses on neurally plausible algorithms of reinforcement learning through numerical simulation. However, most of these models cannot handle observations which are noisy, or occurred in the past, even though these are inevitable and constraining features of learning in real environments. This class of problem is formally known as partially observable reinforcement learning (PORL) problems. It provides a generalization of reinforcement learning to partially observable domains. In addition, observations in the real world tend to be rich and high-dimensional. In this work, we use a spiking neural network model to approximate the free energy of a restricted Boltzmann machine and apply it to the solution of PORL problems with high-dimensional observations. Our spiking network model solves maze tasks with perceptually ambiguous high-dimensional observations without knowledge of the true environment. An extended model with working memory also solves history-dependent tasks. The way spiking neural networks handle PORL problems may provide a glimpse into the underlying laws of neural information processing which can only be discovered through such a top-down approach.     

Heart Rate Variability Biofeedback Improves Cardiorespiratory Resting Function During Sleep

The present study was designed to examine the effect of heart rate variability (HRV) biofeedback on the cardiorespiratory resting function during sleep in daily life. Forty-five healthy young adults were randomly assigned to one of three groups: HRV biofeedback, Autogenic Training (AT), and no-treatment control. Participants in the HRV biofeedback were instructed to use a handheld HRV biofeedback device before their habitual bedtime, those in the AT were asked to listen to an audiotaped instruction before bedtime, and those in the control were asked to engage in their habitual activity before bedtime. Pulse wave signal during sleep at their own residences was measured continuously with a wristwatch-type transdermal photoelectric sensor for three time points. Baseline data were collected on the first night of measurements, followed by two successive nights for HRV biofeedback, AT, or control. Cardiorespiratory resting function was assessed quantitatively as the amplitude of high-frequency (HF) component of pulse rate variability, a surrogate measure of respiratory sinus arrhythmia. HF component increased during sleep in the HRV biofeedback group, although it remained unchanged in the AT and control groups. These results suggest that HRV biofeedback before sleep may improve cardiorespiratory resting function during sleep.     

Zygosity Determination in Hairless Mice by PCR Based on Hrhr Gene Analysis

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr^hr allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr^hr in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr^hr allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr^hr (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr^hr gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.