Gradient thin-layer chromatography of oligonucleotides on DEAE-cellulose: an alternative to homochromatography.

Homochromatography fingerprints are widely used for sequence studies of labeled RNA: however, the more general use of this method is restricted in several aspects by the large excess of RNA introduced by the homomix. Gradient thin-layer chromatography on DEAE-cellulose plates using ammonium formate gradients in 9 m urea provides an efficient procedure for preparing fingerprints of labeled as well as unlabeled RNA, and allows the isolation of oligonucleotides free of salt, urea, and carrier RNA. This method produces fingerprints similar to those obtained by homochromatography under appropriate conditions. Consequently, gradient thin-layer chromatography is a convenient alternative to homochromatography without some of its limitations.     

Increase in drug resistance among Shigella dysenteriae,Sh flexneri,and Sh boydii.

Two thousand three hundred and seventy strains of Shigella dysenteriae, Sh flexneri, and Sh boydii isolated in England and Wales from 1974 to 1978 were tested for resistance to 12 antimicrobial drugs. Eighty per cent of strains were resistant to one or more drugs, with sulphonamide resistance occurring most frequently. Resistance to streptomycin, tetracycline, ampicillin, and chloramphenicol increased during the period, as did the incidence of multiple resistance. Most infections due to Sh dysenteriae, Sh flexneri, and Sh boydii are acquired abroad, and the increasing incidence of drug resistance among these organisms contrasts with the decreasing incidence of resistance among the indigenous Sh sonnei. These findings may indicate the need for better control of antibiotic use, particularly in developing countries.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Medical and surgical approach to laryngeal air sacculitis in a baboon caused by Pasteurella multocida.

Air sacculitis was diagnosed in a chronically chaired baboon, Papio anubis. Pasteurella multocida was repeatedly isolated from the air sac for a period of 1 year. The condition was characterized by the continuous accumulation of either mucoserous or purulent fluid. Biopsies of the air sac taken during the course of the disease initially revealed goblet cell hyperplasia. Later a subepithalial mononuclear or polymorphonuclear infiltrate and necrosis was the predominate finding. Medical therapy was only intermittently successful and consisted of frequent drainage and antibiotics administered locally and intravenously. The condition was resolved after surgical resection of the air sac lining membrane.     

Studies on dehydro-l-ascorbic acid 2-arylhydrazone 3-oximes: Conversion into substituted triazoles and isoxazolines

l-threo-2,3-Hexodiulosono-1,4-lactone 2-(arylhydrazones) (2) were prepared by condensation of dehydro-l-ascorbic acid with various arylhydrazines. Reaction of 2 with hydroxylamine gave the 2-(arylhydrazone) 3-oximes (3). On boiling with acetic anhydride, 3 gave 2-aryl-4-(2,3-di-O-acetyl-l-threo-glycerol-l-yl)-1,2,3-triazole-5-carboxylic acid 5,4¹-lactones (4). On treatment of 4 with liquid ammonia, 2-aryl-4-(l-threo-glycerol-l-yl)-1,2,3-triazole-5-carboxamides (5) were obtained. Acetylation of 5 with acetic anhydride-pyridine gave the triacetates, and vigorous acetylation with boiling acetic anhydride gave the tetraacetyl derivatives. Periodate oxidation of 5 gave the 2-aryl-4-formyl-1,2,3-triazole-5-carboxamides (8), and, on reduction, 8 gave the 2-aryl-4-(hydroxymethyl)-1,2,3-triazole-5-carboxamides, characterized as the monoacetates and diacetates. Controlled reaction of 2 with sodium hydroxide, followed by neutralization, gave 3-(l-threo-glycerol-l-yl)-4,5-isoxazolinedione 4-(arylhydrazones), characterized by their triacetates. Reaction of 2 with HBr-HOAc gave 5-O-acetyl-6-bromo-6-deoxy-l-threo-2,3-hexodiulosono-1,4-lactone 2-(arylhydrazones); these were converted into 4-(2-O-acetyl-3-bromo-3-deoxy-l-threo-glycerol-l-yl)-2-aryl-1,2,3-triazole-5-carboxylic acid 5,4¹-lactones on treatment with acetic anhydride-pyridine.     

Effect of food-deprivation on rat pancreatic islet cells

Somatostatin, insulin and glucagon concentrations in rat pancreas were measured following various intervals of food-deprivation. Tissue concentrations, as measured by radioimmunoassay, were correlated with A-, B-, and D-cell number and size using a scanning integrating image analyzer (Quantimet 720). Alterations in total islet hormone content were not correlated to changes in size or distribution of cells. This implies that changes in tissue content reflect changes in turnover of peptides rather than changes in cell size or number.     

Platelet-derived growth factor isoforms AA, AB, and BB differentially activate poly r(I):r(C)-induced genes in human fibroblast FS4 cells.

Polyribocytidylic-polyriboinosinic acid [poly r(I):r(C)]-inducible genes were isolated by a differential screening procedure from a human fibroblast cell (FS-4) cDNA bank. Among yet unidentified genes (gene 274), one codes for a protein with multiple finger motifs and has previously been detected in endothelial cells after tumor necrosis factor-alpha (TNF-alpha) treatment (A20; Opipari et al., 1990), the second one codes for a variant of the I kappa B family (Haskill et al., 1991), and a third one for the Ca2+ ATPase (isoform 1). Platelet-derived growth factor (PDGF) isoforms (AA, AB, and BB) stimulated the expression of these immediate-early genes. But the extent of the respective induction correlated neither with the number of the two receptors alpha or beta nor with the level of PDGF-stimulated receptor autophosphorylation on tyrosine. Although alpha-receptors were less abundant than beta-receptors (12,500 binding sites were estimated for PDGF-AA, KD 0.03 nM; 20,000 for PDGF-AB, KD 0.03 nM; 35,000 for PDGF-BB KD 0.16 nM) and tyrosine phosphorylation induced by PDGF-AA was significantly less than that evoked by PDGF-BB, some of the investigated genes were more strongly induced by PDGF-AA. We discuss how the differences in the biological potency of the PDGF isoforms may reside in different functions of the two receptors by activation of alternative signaling pathways.     

Tetrahydrobiopterin synthesis. An absolute requirement for cytokine-induced nitric oxide generation by vascular smooth muscle.

Nitric oxide (NO) synthesis is induced in vascular smooth muscle cells by lipopolysaccharide (LPS) where it appears to mediate a variety of vascular dysfunctions. In some cell types tetrahydrobiopterin (BH4) synthesis has also been found to be induced by cytokines. Because BH4 is a cofactor for NO synthase, we investigated whether BH4 synthesis is required for LPS-induced NO production in rat aortic smooth muscle cells (RASMC). The total biopterin content (BH4 and more oxidized states) of untreated RASMC was below our limit of detection. However, treatment with LPS caused a significant rise in biopterin levels and an induction of NO synthesis; both effects of LPS were markedly potentiated by interferon-gamma. 2,4-Diamino-6-hydroxypyrimidine (DAHP), a selective inhibitor of GTP cyclohydrolase I, the rate-limiting enzyme for de novo BH4 synthesis, completely abolished the elevated biopterin levels induced by LPS. DAHP also caused a concentration-dependent inhibition of LPS-induced NO synthesis. Inhibition of NO synthesis by DAHP was reversed by sepiapterin, an agent which circumvents the inhibition of biopterin synthesis by DAHP by serving as a substrate for BH4 synthesis via the pterin salvage pathway. The reversal by sepiapterin was overcome by methotrexate, an inhibitor of the pterin salvage pathway. Sepiapterin, and to a lesser extent BH4, dose-dependently enhanced LPS-induced NO synthesis, indicating that BH4 concentration limits the rate of NO production by LPS-activated RASMC. Sepiapterin also caused LPS-induced NO synthesis to appear with an abbreviated lag period phase, suggesting that BH4 availability also limits the onset of NO synthesis. In contrast to the stimulation of LPS-induced NO synthesis, observed when sepiapterin was given alone, sepiapterin became a potent inhibitor of NO synthesis in the presence of methotrexate. This is attributable to a direct inhibitory action of sepiapterin on GTP cyclohydrolase I, an activity which is only revealed after blocking the metabolism of sepiapterin to BH4. Further studies with sepiapterin, methotrexate, and N-acetylserotonin (an inhibitor of the BH4 synthetic enzyme, sepiapterin reductase) indicated that the BH4 is synthesized in RASMC predominantly from GTP; however, a lesser amount may derive from pterin salvage. We demonstrate that BH4 synthesis is an absolute requirement for induction of NO synthesis by LPS in vascular smooth muscle. Our findings also suggest that pterin synthesis inhibitors may be useful for the therapy of endotoxin- and cytokine-induced shock.