Infection Status of Hospitalized Diarrheal Patients with Gastrointestinal Protozoa, Bacteria, and Viruses in the Republic of Korea

To understand protozoan, viral, and bacterial infections in diarrheal patients, we analyzed positivity and mixed-infection status with 3 protozoans, 4 viruses, and 10 bacteria in hospitalized diarrheal patients during 2004-2006 in the Republic of Korea. A total of 76,652 stool samples were collected from 96 hospitals across the nation. The positivity for protozoa, viruses, and bacteria was 129, 1,759, and 1,797 per 10,000 persons, respectively. Especially, Cryptosporidium parvum was highly mixed-infected with rotavirus among pediatric diarrheal patients (29.5 per 100 C. parvum positive cases), and Entamoeba histolytica was mixed-infected with Clostridium perfringens (10.3 per 100 E. histolytica positive cases) in protozoan-diarrheal patients. Those infected with rotavirus and C. perfringens constituted relatively high proportions among mixed infection cases from January to April. The positivity for rotavirus among viral infection for those aged ≤ 5 years was significantly higher, while C. perfringens among bacterial infection was higher for ≥ 50 years. The information for association of viral and bacterial infections with enteropathogenic protozoa in diarrheal patients may contribute to improvement of care for diarrhea as well as development of control strategies for diarrheal diseases in Korea.     

Laccase‐catalysed polymeric dye synthesis from plant‐derived phenols for potential application in hair dyeing: Enzymatic colourations driven by homo‐ or hetero‐polymer synthesis

Laccase efficiently catalyses polymerization of phenolic compounds. However, knowledge on applications of polymers synthesized in this manner remains scarce. Here, the potential of laccase-catalysed polymerization of natural phenols to form products useful in hair dyeing was investigated. All 15 tested phenols yielded coloured products after laccase treatment and colour diversity was attained by using mixtures of two phenolic monomers. After exploring colour differentiation pattern of 120 different reactions with statistical regression analysis, three monomer combinations, namely gallic acid and syringic acid, catechin and catechol, and ferulic acid and syringic acid, giving rise to brown, black, and red materials, respectively, were further characterized because such colours are commercially important for grey hair dyeing. Selected polymers could strongly absorb visible light and their hydrodynamic sizes ranged from 100 to 400 nm. Analyses of enzyme kinetic constants, liquid chromatography and electrospray ionization-mass spectrometry (ESI-MS) coupled with collision-induced dissociation MS/MS indicate that both monomers in reactions involving catechin and catechol, and ferulic acid and syringic acid, are coloured by heteropolymer synthesis, but the gallic acid/syringic acid combination is based on homopolymer mixture formation. Comparison of colour parameters from these three reactions with those of corresponding artificial homopolymer mixtures also supported the idea that laccase may catalyse either hetero- or homo-polymer synthesis. We finally used selected materials to dye grey hair. Each material coloured hair appropriately and the dyeing showed excellent resistance to conventional shampooing. Our study indicates that laccase-catalysed polymerization of natural phenols is applicable to the development of new cosmetic pigments.     

Insulin-sensitizing activities of tanshinones,diterpene compounds of the root of Salvia miltiorrhiza Bunge

In this study, the effects of the extract and four tanshinone compounds from the dried root of Salvia miltiorrhiza Bunge (Labiatae) on the tyrosine phosphorylation of the insulin receptor (IR) β-subunit and the downstream signaling were examined in Chinese-hamster ovary cells expressing human insulin receptors (CHO/IR cells) as well as in 3T3-L1 adipocytes. In addition the translocation of the glucose transporter 4 was investigated in 3T3-L1 adipocytes. Total extract of Danshen (1–10 μg/ml) and the four tanshinones (10 μM) did not show any activity, but the total extract and the tanshinone I, IIA and 15, 16-dihydrotanshinone I except cryptotanshinone enhanced the activity of insulin (1 nM) on the tyrosine phosphorylation of the IR as well as the activation of the downstream kinases Akt, ERK1/2, and GSK3β. In the adipocytes the same IR-downstream signaling and the translocation of glucose transporter 4 were demonstrated by the three tanshinones in the presence of insulin. These insulin-sensitizing activities of tanshinones may be useful for developing a new class of specific IR activators as anti-diabetic agents.     

<Emphasis Type="Italic">Virgibacillus xinjiangensis</Emphasis> sp. nov., isolated from a Salt Lake of Xin-jiang Province in China

A strictly aerobic Gram-positive, moderately halophilic spore forming bacterium, designated strain SL6-1^T, was isolated from a salt lake in Xin-jiang province, China. Growth of strain SL6-1^T was observed at NaCl concentrations of 0∼20% (w/v) (the optimum being 5∼7%, w/v). The peptidoglycan type of strain SL6-1^T was Alγ-meso-diaminopimelic acid and its major cellular fatty acids were iso-C_14:0 and iso-C_16:0 and ante-iso-C_15:0. The major respiratory isoprenoid quinone was MK-7 and the G+C content of the genomic DNA was 44.5 mol%. The major cellular phospholipids were phosphatidylglycerol and diphosphatidylglycerol. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain SL6-1^T formed a phylogenetic lineage within the genus Virgibacillus. Based on 16S rRNA gene sequence similarity, the strain was most closely related to Virgibacillus olivae E₃₀8^T, Virgibacillus kekensis YIM kkny16^T, Virgibacillus marismortui DSM 12325^T with 97.1%, 97.1%, and 97.0% gene sequence similarities, respectively and the sequence similarities to other related taxa were less than 96.7%. The DNA relatedness values between strain SL6-1^T and V. olivae E₃₀8^T, V. kekensis YIM kkny16^T, V. marismortui DSM 12325^T were 16.7%, 51.0%, and 22.8%, respectively. On the basis of physiological, biochemical and phylogenetic properties, strain SL6-1^T represents a novel species, for which the name Virgibacillus xinjiangensis sp. nov. is proposed. The type strain is SL6-1^T (=KCTC 13128^T =DSM 19031^T).     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

Utility of the Rio Score and Modified Rio Score in Korean Patients with Multiple Sclerosis

Objectives

Early identification of suboptimal responders to multiple sclerosis (MS) treatment is critical for optimizing therapeutic decisions. The Rio score (RS) and modified Rio score (MRS) were developed to discriminate the responses to interferon-beta (IFNB) treatment in MS patients. This study was performed to evaluate the utility of RS and MRS in daily clinical practice in Korea.

Methods

This was a real-world setting, multicenter, retrospective study of MS patients treated with IFNB from 10 hospitals in Korea. We investigated whether the RS and MRS at the early stage of IFNB therapy could predict treatment responses over 3 years. Suboptimal treatment responses at 3 years were defined as the presence of clinical relapse and/or EDSS progression and/or patients who had been treated with INFB for at least for 1 year and therapy was switched due to perceived treatment failure during the 2 years of follow-up.

Results

Seventy patients (50 females and 20 males) were enrolled; 92% (12/13) of patients with high RS and 86% (12/14) of patients with high MRS (score 2 or 3) were suboptimal responders, whereas 93% (53/57) of patients with low RS and 93% (52/56) patients with low MRS (score 0 or 1) showed optimal responses. New active lesions on MRI with clinical relapse in high RS and MRS were the most common combination in suboptimal responders.

Conclusions

We confirmed that RS and MRS at 6–15 months of IFNB therapy were useful for predicting poor responders over 3 years.     

Prognostic Value of Lactate and Central Venous Oxygen Saturation after Early Resuscitation in Sepsis Patients

The objective of this study was to evaluate the prognostic value of static and dynamic variables of central venous oxygen saturation (ScvO₂) and lactate in patients with severe sepsis or septic shock who underwent early quantitative resuscitation. We also investigated whether ScvO₂ measured after initial resuscitation could provide additive prognostic value to that of lactate. We analyzed the sepsis registry for patients presenting to the emergency department and included patients with simultaneous measurements of lactate and ScvO₂ at the time of presentation (H0) and 6 hours (H6) after resuscitation. The primary outcome was 28-day mortality and multivariable logistic analysis was used to adjust for confounders. A total of 363 patients were included, and the overall 28-day mortality was 18%. The area under the receiver operator characteristic curve for predicting 28-day mortality was as follows: lactate (H6), 0.81; lactate (H0), 0.73; relative lactate change, 0.67; ScvO₂ (H6), 0.65; relative ScvO₂ change 0.59; ScvO₂ (H0), 0.58. Patients with lactate normalization showed significantly lower 28-day mortality compared to patients without lactate normalization (3% vs. 28%, P<0.01). However, in those who achieved ScvO₂ (H6) ≥70%, there was a significant difference in 28-mortality only in patients without lactate normalization (21% vs. 39%, P<0.01) but no difference in those with lactate normalization (4% vs. 3%, P = 0.71). In multivariable analysis, lactate normalization was significantly associated with 28-day mortality (adjusted odds ratio [OR] for 28-day mortality, 0.20; 95% confidence interval [CI], 0.07–0.54; P <0.01), but ScvO₂ (H6) ≥70% showed only a marginal association (the adjusted OR for 28-day mortality, 0.51; 95% CI, 0.26–1.01; P = 0.05). ScvO₂ (H6) ≥70% was associated with 28-day mortality only in cases without lactate normalization in subgroup analysis (adjusted OR 0.37, 95% CI, 0.18–0.79; P = 0.01). Six-hour lactate was the strongest predictor of 28-day mortality in patients with severe sepsis or septic shock. Six-hour ScvO₂ provided additional prognostic value only in cases where lactate values were not normalized after resuscitation.