The role of glucagon in the regulation of blood glucose: Model studies

Mathematical models afford a procedure of unifying concepts and hypotheses by expressing quantitative relationships between observables. The model presented indicates the roles of both insulin and glucagon as regulators of blood glucose, albeit in different ranges of the blood glucose concentrations. Insulin secretion is induced during hyperglycemia, while glucagon secretion results during hypoglycemia. These are demonstrated by simulations of a mathematical model conformed to data from the oral glucose tolerance test and the insulin infusion test in normal control subjects and stable and unstable diabetic patients. The model studies suggest the parameters could prove of value in quantifying the diabetic condition by indicating the degree of instability. Presented at the Society for Mathematical Biology Meeting, University of Pennsylvania, Philadelphia, August 19–21, 1976.     

Direct comparison of the rapid axonal transport of norepinephrine and dopamine-β-hydroxylase activity

Stop-flow techniques were used to examine the rapid axonal transport of norepinephrine in rabbit sciatic nerves. When the midpoint of a nerve incubated in vitro was cooled to 2°C while the remainder was kept at 37°C, norepinephrine accumulated proximal to the cooled region at a rate corresponding to an average transport velocity between 5 and 6 mm/hr in a distal direction. Since only about half of the norepinephrine appeared to be free to move, the mean velocity of the moving fraction was probably twice as great. No norepinephrine accumulated distal to a broad cooled region under conditions in which there would have been a significant accumulation of dopamine-β-hydroxylase activity. Therefore, unlike dopamine-β-hydroxylase, norepinephrine may not be subject to rapid retrograde transport. When nerves that had been locally cooled for 1.5 hr were rewarmed uniformly to 37°C, a wave of norepinephrine moved exclusively in a distal direction. The peak of this wave moved at a velocity of 12.2 ± 0.5 mm/hr or 293 ± 12 mm/day; the front of the wave moved at about 18 mm/hr. or 430 mm/day; and the tail probably moved faster than 6 mm/hr. This spectrum of velocities was virtually identical to the one displayed by the wave of dopamine-β-hydroxylase activity that was generated under the same conditions. Our results are consistent with the conclusion that all axonal structures containing norepinephrine also contain dopamine-β-hydroxylase, but they are not consistent with the converse.     

The second polar lobe of theSabellaria cementarium embryo plays an inhibitory role in apical tuft formation

Summary The embryo ofSabellaria cementarium (Polychaeta) forms a polar lobe at each of the first two cleavage divisions which becomes absorbed into one of the blastomeres at the end of the division. Lobe removal experiments show that the polar lobe preceding first cleavage is necessary for the development of the apical tuft and the posttrochal region of the trochophore larva. The polar lobe preceding second cleavage is smaller than the first polar lobe and is necessary only for post-trochal region development. In blastomere isolation experiments, isolates containing the C but not the D blastomere form apical tufts. Isolates containing the D but not the C blastomere do not form apical tufts. When the polar lobe preceding second cleavage is removed and the C and D blastomeres are separated and raised in isolation, each can form an apical tuft. When the second cleavage is equalized with sodium dodecyl sulfate (SDS) such that both the C and the D blastomeres receive second polar lobe material, no apical tuft is formed. These results suggest that apical tuft determinants are distributed to both the C and D blastomeres at second cleavage but that the second polar lobe contains an inhibitor for apical tuft formation which is shunted to the D blastomere after the completion of second cleavage.     

Cellulose acetate electrophoresis of protein kinases: Detection of the active forms using various substrates

Electrophoresis on cellulose acetate strips was used to analyze protein kinases from normal rat liver. In addition to already well-characterized cAMP-dependent protein kinases type I and II and cAMP-independent casein kinases I and II, this method enabled the detection of several supplementary bands corresponding to kinases which were investigated according to their substrate specificity, activation by cAMP, and inhibition by the specific inhibitor of the catalytic subunit of cAMP-dependent protein kinases or by heparin. Using this rapid, sensitive, and resolutive electrophoretic method, different isozyme patterns could be obtained starting from minute amounts of different types of biological material.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Stress response induced by DNA damage leads to specific, delayed and untargeted mutations

Summary Cells of the mouse T-lymphoma line GRSL13 were treated with 8-methoxy-psoralen plus longwave ultraviolet light (PUVA) under conditions where the biological effects are mainly due to non-persistent DNA crosslinks (PUVA-CL treatment). Fluctuation analysis showed that PUVA-CL treatment resulted in an enhancement of the mutation rate in the progeny of treated cells, which persisted until the eleventh generation after treatment. Since only 5 cross-links are available to account for 52 mutational events observed in the coding region, about 90% of the induced mutational events must have been untargeted. This was confirmed by molecular analysis of these mutations, which showed that 53% of the point mutations arose at sites which are not a target for psoralens. This supports the hypothesis that stress responses may give rise to untargeted mutagenesis. Further support for this hypothesis is provided by the observation that 8-methoxy-psoralen (8-MOP) or UVA alone (both of which are known to induce many pleiotropic effects) each acted as indirect mutagen by enhancing the mutation rate 2–4 fold in the progeny of treated cells.     

Isolation and sequence analysis of the genomic DNA fragment encoding an aspartic proteinase inhibitor homologue from potato (Solanum tuberosum L.)

A genomic DNA clone encoding an aspartic proteinase inhibitor of potato was isolated from a lambda EMBL3 phage library using the aspartic proteinase inhibitor cDNA as a hybridization probe. The gene has all characteristic sequences normally found in eucaryotic genes. Typical CAAT and TATA box sequences were found in the 5-upstream region. In this part are also two putative regulatory AGGA box sequences located. In the genomic sequence there are no intron sequences interrupting the coding region. An open reading frame of the gene encodes a precursor protein of 217 amino acids which shows high percent identity with the aspartic proteinase inhibitor cDNA.     

Comparison of Representative Strains of Infectious Hematopoietic Necrosis Virus by Serological Neutralization and Cross-Protection Assays

Infectious hematopoietic necrosis virus (IHNV) is a pathogen of young salmon and trout. Viral epizootics among these fish in private and public rearing facilities have been a problem in the northwestern United States from California to Alaska, and an IHNV vaccine has been sought by the aquaculture experts. Since an IHNV vaccine must be designed to immunize against all viral serotypes, an analysis of IHNV serotypes was made. A large number of viruses from widely separated geographic locations and different fish species had already been placed in one of five electropherotypes by the migration of the virion proteins in sodium dodecyl sulfate-polyacrylamide gels. Also, there was evidence that some of these virus isolates had differences in virulence for chinook salmon, rainbow trout, or kokanee salmon. Previous serological studies with polyclonal rabbit antisera and three IHNV isolates indicated that there was only one serotype (B. B. McCain, J. L. Fryer, and K. S. Pilcher, Proc. Soc. Exp. Biol. Med. 137:1042-1046, 1971). A substantial number of new IHNV isolations have been made since that study, and thus a more extensive comparison was made of 10 different IHNV isolates representing the five electropherotypes. This report shows that the glycoprotein from a single isolate of IHNV can induce a protective immune response in vivo to the five IHNV electropherotypes. Plaque reduction neutralization assays indicated that there was only one serotype. Thus, despite the differences observed in the migration of the structural proteins for IHNV isolated from separate geographic locations and different fish species, only one neutralizing virus type was identified.     

Microcarrier culture of bowes melanoma cells in serum-free medium with Human plasma fraction IV-4+ V

Bowes melanoma cells were cultivated successfully in a serum-free medium which was constructed by the concept of maximum retention of proteins from fractionated human plasma having growth stimulatory activities. The cells could be cultivated in the serum-free medium without any adaptation period. The major serum-free component of the medium was the fraction IV-4 + V of the Cohn fractionation process of human plasma. Approximately six times increase of tissue-type plasminogen activator (t-PA) activity as compared with that in serum-free medium even though the cell growth was much slower. In addition, the growth stimulatory activities of thrombin and fibronectin were investigated during the cultivation of Bowes melanoma cells in this serum-free medium. These proteins contributed significantly to the enhanced growth of cells by reducing doubling time to 25 and 35 h as compared with 55 h in the serum-free medium without them. Especially, fibronectin supported cells to propagate near to the maximum cell density achieved in the medium with 10% FBS.     

Background and peak evaluation of one parameter flow karyotypes on a PC/AT computer

Flow cytometry has become a fast, quantitative method for the classification of metaphase chromosomes in suspension (flow karyotyping) stained with fluorescent dyes. Such a flow karyotype (frequency distribution of the fluorescence signals) consists of several peaks. The peak pattern characterizes the analyzed chromosome complement. In many cases flow karyotypes contain a continuum of an unspecific background deriving from chromosome fragments or chromosome aggregates. For the quantitative evaluation of a flow karyotype this background has to be subtracted by a suitable background function. In this approach the application of chi 2-functions is described. The feasibility of this method to flow karyotypes has been concluded from a computer simulation of chromosome breaking under different conditions. In spite of the rather rough assumptions of the model compared to the complex reasons that influence chromosome breaking, the chi 2-function fits the background better than the exponential function in current use. The approximation of a Gaussian distribution function by the chi 2-function also makes it possible to use the same subtraction procedure for chromosome aggregates. The procedure was tested for isolated chromosomes of Chinese hamster cell lines under different states of breaking. For further evaluation of one parameter flow karyotypes a setup of computer routines has been developed for PC/AT and compatible computer systems. Different peak values of these flow karyotypes can be determined (e.g. peak mean, standard deviation, absolute and relative peak area etc.). The applied method is to fit Gaussian curves to each peak of an experimentally measured histogram by using an interactive program. Fluctuations depending on 'noise' may be suppressed by a 'k-nearest-neighbours' smoothing procedure.