Insulin-sensitizing activities of tanshinones,diterpene compounds of the root of Salvia miltiorrhiza Bunge

In this study, the effects of the extract and four tanshinone compounds from the dried root of Salvia miltiorrhiza Bunge (Labiatae) on the tyrosine phosphorylation of the insulin receptor (IR) β-subunit and the downstream signaling were examined in Chinese-hamster ovary cells expressing human insulin receptors (CHO/IR cells) as well as in 3T3-L1 adipocytes. In addition the translocation of the glucose transporter 4 was investigated in 3T3-L1 adipocytes. Total extract of Danshen (1–10 μg/ml) and the four tanshinones (10 μM) did not show any activity, but the total extract and the tanshinone I, IIA and 15, 16-dihydrotanshinone I except cryptotanshinone enhanced the activity of insulin (1 nM) on the tyrosine phosphorylation of the IR as well as the activation of the downstream kinases Akt, ERK1/2, and GSK3β. In the adipocytes the same IR-downstream signaling and the translocation of glucose transporter 4 were demonstrated by the three tanshinones in the presence of insulin. These insulin-sensitizing activities of tanshinones may be useful for developing a new class of specific IR activators as anti-diabetic agents.     

<Emphasis Type="Italic">Virgibacillus xinjiangensis</Emphasis> sp. nov., isolated from a Salt Lake of Xin-jiang Province in China

A strictly aerobic Gram-positive, moderately halophilic spore forming bacterium, designated strain SL6-1^T, was isolated from a salt lake in Xin-jiang province, China. Growth of strain SL6-1^T was observed at NaCl concentrations of 0∼20% (w/v) (the optimum being 5∼7%, w/v). The peptidoglycan type of strain SL6-1^T was Alγ-meso-diaminopimelic acid and its major cellular fatty acids were iso-C_14:0 and iso-C_16:0 and ante-iso-C_15:0. The major respiratory isoprenoid quinone was MK-7 and the G+C content of the genomic DNA was 44.5 mol%. The major cellular phospholipids were phosphatidylglycerol and diphosphatidylglycerol. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain SL6-1^T formed a phylogenetic lineage within the genus Virgibacillus. Based on 16S rRNA gene sequence similarity, the strain was most closely related to Virgibacillus olivae E₃₀8^T, Virgibacillus kekensis YIM kkny16^T, Virgibacillus marismortui DSM 12325^T with 97.1%, 97.1%, and 97.0% gene sequence similarities, respectively and the sequence similarities to other related taxa were less than 96.7%. The DNA relatedness values between strain SL6-1^T and V. olivae E₃₀8^T, V. kekensis YIM kkny16^T, V. marismortui DSM 12325^T were 16.7%, 51.0%, and 22.8%, respectively. On the basis of physiological, biochemical and phylogenetic properties, strain SL6-1^T represents a novel species, for which the name Virgibacillus xinjiangensis sp. nov. is proposed. The type strain is SL6-1^T (=KCTC 13128^T =DSM 19031^T).     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

Delphinidin prevents hypoxia-induced mouse embryonic stem cell apoptosis through reduction of intracellular reactive oxygen species-mediated activation of JNK and NF-κB, and Akt inhibition

Delphinidin, gallic acid, betulinic acid, and ursolic acid, which are bio-active ingredients in a variety of fruits, vegetables, and herbs, have potent antioxidant activity and various biological activities. However, it is not clear whether these bio-active ingredients can significantly contribute to the protection of embryonic stem (ES) cells from hypoxia-induced apoptosis. In the present study, hypoxia-induced ES cells apoptosis with time, which were abrogated by pretreatment with all ingredients. Hypoxia-induced ROS generation was blocked by pretreatment with all ingredients in a dose-dependent manner, with the maximum ROS scavenging effect observed for delphinidin. Hypoxia increased phosphorylation of JNK and NF-κB were blocked by pretreatment of delphinidin as well as NAC. Hypoxia decreased phosphorylation of Akt^thr308 and ^ser473; these decreases were reversed by pretreatment with delphinidin or NAC. However, Akt inhibition did not affect NF-κB phosphorylation. Delphinidin attenuated the hypoxia-induced increase in Bax, cleaved caspase-9, cleaved caspase-3, and decrease in Bcl-2, which were diminished by pretreatment of Akt inhibitor. Hypoxia induced Bax translocation from the cytosol to mitochondria. Furthermore, hypoxia induced mitochondria membrane potential loss and cytochrome c release in cytosol, which were blocked by delphinidin pretreatment. Hypoxia induced cleavage of procaspase-9 and procaspase-3 which were blocked by delphinidin or SP600125, but Akt inhibitor abolished the protection effect of delphinidin. Moreover, inhibition of JNK and NF-κB abolished hypoxia-induced ES cell apoptosis and inhibition of Akt attenuated delphinidin-induced blockage of apoptosis. The results indicate that delphinidin can prevent hypoxia-induced apoptosis of ES cells through the inhibition of JNK and NF-κB phosphorylation, and restoration of Akt phosphorylation.     

Prognostic Value of Lactate and Central Venous Oxygen Saturation after Early Resuscitation in Sepsis Patients

The objective of this study was to evaluate the prognostic value of static and dynamic variables of central venous oxygen saturation (ScvO₂) and lactate in patients with severe sepsis or septic shock who underwent early quantitative resuscitation. We also investigated whether ScvO₂ measured after initial resuscitation could provide additive prognostic value to that of lactate. We analyzed the sepsis registry for patients presenting to the emergency department and included patients with simultaneous measurements of lactate and ScvO₂ at the time of presentation (H0) and 6 hours (H6) after resuscitation. The primary outcome was 28-day mortality and multivariable logistic analysis was used to adjust for confounders. A total of 363 patients were included, and the overall 28-day mortality was 18%. The area under the receiver operator characteristic curve for predicting 28-day mortality was as follows: lactate (H6), 0.81; lactate (H0), 0.73; relative lactate change, 0.67; ScvO₂ (H6), 0.65; relative ScvO₂ change 0.59; ScvO₂ (H0), 0.58. Patients with lactate normalization showed significantly lower 28-day mortality compared to patients without lactate normalization (3% vs. 28%, P<0.01). However, in those who achieved ScvO₂ (H6) ≥70%, there was a significant difference in 28-mortality only in patients without lactate normalization (21% vs. 39%, P<0.01) but no difference in those with lactate normalization (4% vs. 3%, P = 0.71). In multivariable analysis, lactate normalization was significantly associated with 28-day mortality (adjusted odds ratio [OR] for 28-day mortality, 0.20; 95% confidence interval [CI], 0.07–0.54; P <0.01), but ScvO₂ (H6) ≥70% showed only a marginal association (the adjusted OR for 28-day mortality, 0.51; 95% CI, 0.26–1.01; P = 0.05). ScvO₂ (H6) ≥70% was associated with 28-day mortality only in cases without lactate normalization in subgroup analysis (adjusted OR 0.37, 95% CI, 0.18–0.79; P = 0.01). Six-hour lactate was the strongest predictor of 28-day mortality in patients with severe sepsis or septic shock. Six-hour ScvO₂ provided additional prognostic value only in cases where lactate values were not normalized after resuscitation.     

Genetic differentiation of piscivorous chub (genus Opsariichthys) in Japan,Korea and Russia

A comparison of allozyme variation, restriction fragment length polymorphisms in the mitochondrial DNA and partial sequences of the ND II gene (496 bp) was made among two lacustrine populations of the piscivorous chub (Opsariichthys uncirostris uncirostris) in Japan, four fluvial populations in Korea, one lacustrine population in Russia and one specimen from the Amur River (O. u. amurensis). All analyses indicate that the Japanese populations of piscivorous chub are separable from the Asian mainland populations of Korea and Russia. The latter populations were further divided into the Korean and Russian fish. Although opinions are divided on the phylogenetic position of the population in Lake Mikata, Japan, which shows unique morphological traits intermediate between those of the population in Lake Biwa and the mainland populations, the current analysis indicates a closer relationship to the population in Lake Biwa.     

Rat mesenchymal stem cells increase tyrosine hydroxylase expression and dopamine content in ventral mesencephalic cells in vitro

Mesenchymal stem cells (MSCs) are pluripotent adult stem cells. It has been shown that MSCs secrete neurotrophic factors involving nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF). Also, these neurotrophic factors can upregulate tyrosine hydroxylase (TH) gene expression in PC12 cells and neural stem cells. Here, we investigated the effect of co-culturing rat E13.5 ventral mesencephalic cells (VMCs) with MSCs from rat bone marrow on TH expression and dopamine (DA) content. The study consisted of 3 groups: MSC, VMC and a combined MSC+VMC group. All groups were cultured in serum-free neuro-basal medium for 3 days. Thereafter, each group was analyzed by RT-PCR, western blotting, and HPLC. The co-culture group showed a higher expression at TH and DA than the VMC group. However, TH and DA were not present in the MSC group. These observations suggest that MSCs could be an alternative source for treating neurodegenerative diseases such as Parkinson's disease (PD).     

Morphology of calretinin and tyrosine hydroxylase-immunoreactive neurons in the pig retina

The morphology of calretinin- and tyrosine hydroxylase-immunoreactive (IR) neurons in adult pig retina was studied. These neurons were identified using antibody immunocytochemistry. Calretinin immunoreactivity was found in numerous cell bodies in the ganglion cell layer. Large ganglion cells, however, were not labeled. In the inner nuclear layer, the regular distribution of calretinin-IR neurons, the inner marginal location of their cell bodies in the inner nuclear layer, and the distinctive bilaminar morphologies of their dendritic arbors in the inner plexiform layer suggested that these calretinin-IR cells were AII amacrine cells. Calretinin immunoreactivity was observed in both A-and B-type horizontal cells. Neurons in the photoreceptor cell layer were not labeled by this antibody. The great majority of tyrosine hydroxylase-IR neurons were located at the innermost border of the inner nuclear layer (conventional amacrines). The processes were monostratified and ran laterally within layer 1 of the inner plexiform layer. Some of the tyrosine hydroxylase-IR neurons were located in the ganglion cell layer (displaced amacrines). The processes of displaced tyrosine hydroxylase-IR amacrine cells were also located within layer 1 of the inner plexiform layer. Some processes of a few neurons were located in the outer plexiform layer. A very low density of neurons had additional bands of tyrosine hydroxylase-IR processes in the middle and deep layers of the inner plexiform layer. The processes of tyrosine hydroxylase-IR neurons extended radially over a wide area and formed large, moderately branched dendritic fields. These processes occasionally had varicosities and formed "dendritic rings". These results indicate that calretinin- and tyrosine hydroxylase-IR neurons represent specific neuronal cell types in the pig retina.