Olive oil addition in insect cell cultivation

Adding olive oil to an insect cell (Spodoptera frugiperda) cultivation with a TNM-FH medium enhanced cell growth. In the static cultivation, growth with 0.5% oil increased viable cell density by 32%, while cultivation in spinner flasks agitated at 260 rpm increased by 64%. With a gradual increase of agitation from 60 rpm to 500 rpm, the viable cell density was 81% higher than that without the olive oil supplement.     

Predicted secondary and tertiary structures of carp gamma-crystallins with high methionine content: role of methionine residues in the protein stability.

A systematic structural comparison of several carp gamma-crystallins with high methionine contents was made by the secondary-structure prediction together with computer model-building based on the established X-ray structure of calf gamma-II crystallin. The overall surface hydrophilicity profile and the distribution of helices, beta-sheets, and beta-turns along the polypeptide chains are very similar among these carp gamma-crystallins. In addition, their general polypeptide packing is close to the characteristic 2 domain/4 motif Greek key three-dimensional conformation depicted for the calf gamma-II crystallin. Interestingly, most hydrophobic methionine residues are located on the protein surface with only a few buried inside the protein surface or in the interface between two motifs of each domain. The exposed hydrophobic and polarizable methionine cluster on the protein surface may have a bearing on the crystallin stability and dense packing in the piscine species, and probably also provides a malleable nonpolar surface for the interaction with other crystallin components for the maintenance of a clear and transparent lens.     

Enantioselective hydrolysis of hydrophobic amino acid derivatives by lipases

Microbial lipases preferentially cleave the L-isomers of N-benzyloxycarbonyl (Z)-hydrophobic D,L-amino acid methyl esters which is the same as that of subtilisin. This implies that lipases and proteases may share the same ancestor in the evolutionary point and lipases can be practically applied to resolve racemic hydrophobic amino acid derivatives.     

Cloning and characterization of the carp prolactin gene

A carp genomic DNA clone containing the carp prolactin (Prl) gene was isolated with carp Prl cDNA as a probe. The organization of the carp Prl gene was determined by restriction nuclease mapping and nucleotide sequencing. The Prl gene comprises approx. 2.8 kilobasepairs (kb) of DNA including the 5'-flanking region, five exons, four introns and the 3'-flanking region. Analysis of the 5'-flanking region reveals (1) the sequence TATATAAT at positions -38 to -31 upstream from the cap site which was found to be a guanine residue, and (2) the palindrome, CTCATTGCATATACAAATGAG at positions -79 to -59. The carp Prl gene matches with the reported cDNA except for one difference in coding region and five in the 3'-flanking region, while the encoded amino acid sequences are identical. The arrangement of exons and introns is very similar to that seen in carp GH as well as mammalian Prl, which, however, have much longer introns.     

Comparison of the gamma-crystallins isolated from eye lenses of shark and carp. Unique secondary and tertiary structure of shark gamma-crystallin

gamma-Crystallin isolated from the shark of cartilaginous fishes was compared with the cognate gamma-crystallin from the carp of bony fishes. Distinct differences in amino acid compositions, primary, secondary and tertiary structures were found. The most salient features of shark gamma-crystallin lie in the fact that this crystallin possessed a significant alpha-helical structure in the peptide backbone as revealed by circular dichroism study, in contrast to those orthologous gamma-crystallins from other vertebrate species including bony fishes which all show a predominant beta-sheet secondary structure. The tertiary structure as reflected in the intrinsic microenvironments of various aromatic amino acids in the native crystallins also shows unambiguous differences between these two classes of gamma-crystallins. N-Terminal sequence analysis corroborates the structural differences between shark and carp gamma-crystallins. gamma-Crystallin from the more primitive shark seems to be more in line with the main evolutionary phylogeny leading to the modern mammalian gamma-crystallin.     

Transient Transfection Factors for High-Level Recombinant Protein Production in Suspension Cultured Mammalian Cells

The efficient transfection of cloned genes into mammalian cells system plays a critical role in the production of large quantities of recombinant proteins (r-proteins). In order to establish a simple and scaleable transient protein production system, we have used a cationic lipid-based transfection reagent-FreeStyle MAX to study transient transfection in serum-free suspension human embryonic kidney (HEK) 293 and Chinese hamster ovary (CHO) cells. We used quantification of green fluorescent protein (GFP) to monitor transfection efficiency and expression of a cloned human IgG antibody to monitor r-protein production. Parameters including transfection reagent concentration, DNA concentration, the time of complex formation, and the cell density at the time of transfection were analyzed and optimized. About 70% GFP-positive cells and 50-80 mg/l of secreted IgG antibody were obtained in both HEK-293 and CHO cells under optimal conditions. Scale-up of the transfection system to 1 l resulted in similar transfection efficiency and protein production. In addition, we evaluated production of therapeutic proteins such as human erythropoietin and human blood coagulation factor IX in both HEK-293 and CHO cells. Our results showed that the higher quantity of protein production was obtained by using optimal transient transfection conditions in serum-free adapted suspension mammalian cells.     

A novel in vitro retinal differentiation model by co-culturing adult human bone marrow stem cells with retinal pigmented epithelium cells

Human retinal pigment epithelium (HRPE) cells are important in maintaining the normal physiology within the neurosensory retina and photoreceptors. Recently, transplantation of HRPE has become a possible therapeutic approach for retinal degeneration. By negative immunoselection (CD45 and glycophorin A), in this study, we have isolated and cultivated adult human bone marrow stem cells (BMSCs) with multilineage differentiation potential. After a 2- to 4-week culture under chondrogenic, osteogenic, adipogenic, and hepatogenic induction medium, these BMSCs were found to differentiate into cartilage, bone, adipocyte, and hepatocyte-like cells, respectively. We also showed that these BMSCs could differentiate into neural precursor cells (nestin-positive) and mature neurons (MAP-2 and Tuj1-positive) following treatment of neural selection and induction medium for 1 month. Furthermore, the plasticity of BMSCs was confirmed by initiating their differentiation into retinal cells and photoreceptor lineages by co-culturing with HRPE cells. The latter system provides an ex vivo expansion model of culturing photoreceptors for the treatment of retinal degeneration diseases.