Quantification of concentration changes in neonatal human cerebral oxidized cytochrome oxidase.

The oxygenation of cerebral cytochrome oxidase in vivo was investigated in eight newborn preterm infants. Near-infrared spectroscopy was used to quantify changes in the concentration of oxidized cytochrome oxidase ([CytO2]) observed during alterations in arterial oxygen saturation (SaO2) in the range of 85-99% and of carbon dioxide tension (PaCO2) in the range of 4.3-9.6 kPa. No relation was found between changes in SaO2 and [CytO2]. Alterations in PaCO2 were positively related both to changes in [CytO2] and total cerebral hemoglobin concentration [( Hb]t). The changes in [CytO2] ranged from 0.09 to 0.33 (median 0.21) mumol.l-1.kPa-1. The ratio [CytO2]/[Hb]t ranged from 0.06 to 0.12 (median 0.08). The relation of delta [CytO2] to the change in cerebral blood volume (delta CBV) was calculated: delta [CytO2]/delta CBV ranged from 0.09 to 0.18 (median 0.11) mumol/ml. These results define a fraction of cerebral cytochrome oxidase in the newborn infant that is oxidized after an increase in PaCO2 but demonstrate that a change in SaO2 in the range studied was not sufficient by itself to change [CytO2]. They differ from results of studies in adults; this may reflect significant differences between adult and neonatal brain.     

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.     

Localization of retinol-binding protein messenger RNA in the rat kidney and in perinephric fat tissue

The cellular localization of retinol-binding protein (RBP) messenger RNA (mRNA) in the kidney, and the developmental pattern of the renal expression of the RBP gene, were studied in the Sprague-Dawley rat. In situ hybridization studies were conducted with single-stranded cRNA probes, using sections of adult and young rat kidneys. These studies revealed specific localization of RBP mRNA in the outer stripe of the medulla, specifically localized in the S3 segment of the proximal tubules. Northern blot analysis demonstrated that RBP mRNA was not detectable in the kidney before birth or during the first week postpartum, but was clearly detected by the end of the second week of age. No RBP mRNA was observed in the kidney by in situ hybridization at 12 days of age. At 26 days of age, however, RBP mRNA was clearly detected by the in situ hybridization technique, localized in the same anatomic region as that observed in the adult kidney. Transthyretin mRNA was not detected in the adult kidney. Previous studies have shown that immunoreactive RBP is localized in the convoluted segment of the proximal tubules of the rat kidney. The present results demonstrate that RBP mRNA in the kidney is localized in an anatomic region (the S3 segment of the proximal tubules) different from that of immunoreactive RBP. In addition, an intense RBP mRNA hybridization signal was detected in the perinephric fat tissue of 26- and 40-day-old and adult rats. Further analysis of RNA from epididymal fat showed a level of RBP mRNA approximately 20% of that of liver. The function of RBP synthesized in the kidney and adipose tissue remains to be determined. We have previously hypothesized that RBP synthesized in extrahepatic tissue may function in the recycling of retinol back to the liver or to other target tissues.     

Complement phenotypes in patients with psoriasis

Phenotype frequencies for the complement proteins C4A, C4B, Bf (factor B) and C3 were performed for 49 Caucasian patients with psoriasis. The C4*A6 allele was present in 26.6% of the patients as compared to 5.4% of healthy regional Caucasian controls, p less than 0.001, relative risk = 6.28. The C4*A6 allele is known to be in linkage disequilibrium with the HLA B17 allele and to produce a non-functional gene product when it occurs with the B17 allele. HLA B17 is known to be associated with psoriasis in many Caucasian populations. Additional findings in the present study were a significant reduction in the C4B*2 allele frequency, a non-significant increase in the Bf*F allele frequency and no difference for Bf or C3 phenotype frequencies in the patients with psoriasis as compared to the controls.     

Human monocytes selectively bind to cells expressing the tumorigenic phenotype

Summary The characteristics of the binding of human monocytes to tumor cells were studied by a newly developed microassay. First, we determined the kinetics and optimal conditions of the binding. Monocytes recognized and bound to tumor cells very rapidly within 10–20 min of cellular interaction. Binding was also more efficient at 37°C suggesting that active metabolism of monocytes is required. Second, we determined that selective binding of monocytes to cells with tumorigenic phenotypes occurs. For this purpose, lymphocytic leukemia cell lines versus normal lymphocytes, and tumorigenic versus nontumorigenic hybrids from the same parental lines were compared as the targets of the binding assay. In both cases, neoplastic cells were selectively bound by monocytes. Although tumor cells were bound rapidly and selectively by monocytes, initial recognition and binding did not necessarily lead to subsequent tumor cell lysis. This is based on the observation that some tumorigenic parental and hybrid lines were avidly bound by monocytes yet not subsequently killed in a cytotoxicity assay.This work was supported in part by a grant from the National Institutes of Health CA42992 and a grant from the Kleberg foundation Abbreviations used: [¹²⁵I]IdUrd [¹²⁵I]iododeoxyuridine; rIFN-, recombinant human interferon ; IL-1, interleukin 1; rTNF, recombinant human tumor necrosis factor     

The transport of class I major histocompatibility complex antigens is determined by sequences in the α1 and α2 protein domains

The transport of human-mouse hybrid class I histocompatibility antigens has been studied in a mutant human cell line, 174 × CEM.T2 (T2). T2, a somatic cell hybrid of human B- and T-lymphoblastoid cell lines (B-LCL and T-LCL, respectively), synthesizes HLA-A2 and HLA-B5 glycoproteins, but expresses only low levels of A2 and undetectable levels of B5 at the cell surface. We have previously shown that the products of human class I genes introduced into T2 by transfection behave like the endogenous HLA-B5 glycoproteins, while the products of mouse class I alleles similarly introduced are transported normally to the cell surface. We have now determined that the surface expression of class I glycoproteins in T2 depends on the origin of the ₁ and ₂ domains. Human (HLA-B7) and mouse (H-2D ^p ) hybrid class I genes, encoding the leader, ₁, and ₂ sequences of one species fused to the ₃, transmembrane, and cytoplasmic domains of the other, were transfected into T2. Normal surface expression of the hybrid class I molecule was observed in T2 only when the leader, ₁, and ₂-encoding exons were derived from the mouse gene. The reciprocal construct, encoding human leader, ₁, and ₂ domains fused to the mouse ₃, transmembrane, and cytoplasmic regions, resulted in biosynthesis of a hybrid glycoprotein which was not transported to the cell surface. The products of both constructs were expressed normally in control cells. The effects of glycosylation on class I antigen transport were also studied using mutant class I constructs with altered glycosylation sites. Two mutant B7 genes encoding either an extra glycosylation site at position 176 or no glycosylation sites were transfected into T2. These mutant products were expressed at the cell surface in control cells, but were synthesized and not surface-expressed in T2. These data demonstrate that the HLA/H-2 transport dichotomy in T2 is a function of the origin of the ₁ and/or ₂ domains of the class I glycoprotein, and is not a reflection of glycosylation differences between the human and mouse molecules. Offprint requests to: P. Cresswell.     

Effect of membrane potential on band 3 conformation in the human erythrocyte membrane detected by triplet state quenching experiments.

The triplet lifetime and absorption anisotropy decay of eosin-labeled band 3 was measured in resealed erythrocyte ghosts. Membrane potentials were generated by the addition of valinomycin in the presence of a K+ gradient. Neither negative nor positive membrane potentials had any detectable effect on the rotational diffusion of band 3 nor on the eosin triplet lifetime. The membrane potential did, however, affect quenching of the eosin triplet state by I- and TEMPO (2,2,6,6-tetramethylpiperidine-N-oxyl). Quenching was enhanced by a negative membrane potential (negative inside) and reduced by a positive membrane potential. In addition, it was found that a negative membrane potential enhanced the efficiency of eosin labeling of band 3 in intact erythrocytes. A positive membrane potential had the opposite effect. These results indicate that the eosin binding site on band 3 becomes more accessible to the extracellular aqueous phase in the presence of a negative membrane potential and less accessible in the presence of a positive membrane potential. Quenching by I- and TEMPO of the triplet state of eosin-labeled band 3 was further investigated as a function of pH. Quenching by TEMPO and its dependence on membrane potential were relatively insensitive to pH. In contrast, the rate of quenching by I- showed a marked decrease over the range pH 5.5-9.5. Moreover, the effect of a negative membrane potential on I- quenching also varied with pH. These results are discussed on the supposition that the eosin probe is located in the anion access channel of band 3.(ABSTRACT TRUNCATED AT 250 WORDS)     

Development of Photosystem II in dark grown Chlamydomonas reinhardtii. A light-dependent conversion of PS IIβ, QB-nonreducing centers to the PS IIα, QB-reducing form

The green alga Chlamydomonas reinhardtii is a facultative heterotroph and, when cultured in the presence of acetate, will synthesize chlorophyll (Chl) and photosystem (PS) components in the dark. Analysis of the thylakoid membrane composition and function in dark grown C. reinhardtii revealed that photochemically competent PS II complexes were synthesized and assembled in the thylakoid membrane. These PS II centers were impaired in the electron-transport reaction from the primary-quinone electron acceptor, Q_A, to the secondary-quinone electron acceptor, Q_B (Q_B-nonreducing centers). Both complements of the PS II Chl a–b light harvesting antenna (LHC II-inner and LHC II-peripheral) were synthesized and assembled in the thylakoid membrane of dark grown C. reinhardtii cells. However, the LHC II-peripheral was energetically uncoupled from the PS II reaction center. Thus, PS II units in dark grown cells had a -type Chl antenna size with only 130 Chl (a and b) molecules (by definition, PS II units lack LHC II-peripheral). Illumination of dark grown C. reinhardtii caused pronounced changes in the organization and function of PS II. With a half-time of about 30 min, PS II centers were converted froma Q_B-nonreducing form in the dark, to a Q_B-reducing form in the light. Concomitant with this change, PS II units were energetically coupled with the LHC II-peripheral complement in the thylakoid membrane and were converted to a PS II form. The functional antenna of the latter contained more than 250 Chl(a+b) molecules. The results are discussed in terms of a light-dependent activation of the Q_A-Q_B electron-transfer reaction which is followed by association of the PS II unit with a LHC II-peripheral antenna and by inclusion of the mature form of PS II (PS II) in the membrane of the grana partition region.Abbreviations Chl chlorophyll - PS photosystem - Q_A primary quinone electron acceptor of PS II - Q_B secondary quinone electron acceptor of PS II - LHC light harvesting complex - F₀ non-variable fluorescence yield - F_plf intermediate fluorescence yield plateau leyel - F_max maximum fluorescence yield - F_i initial fluorescence yield increase from F₀ to F_pl (F_pl–F₀) - F_v total variable fluorescence yield (F_m–F0) - DCMU dichlorophenyl-dimethylurea     

Are natural lipids UV-screening agents?

Summary Isolated lipids from Deinococcus radiodurans were reconstituted at final concentrations of 1 mg/ml into dioleoyl phosphatidyl choline (DOPC) vesicles and assayed for the ability to protect cells of Escherichia coli against killing by UV light (254 nm). Values of D₃₇ (UV dose required to reduce the number of surviving cells to 37% of the original number) were calculated from killing curves. E. coli was afforded the greatest protection with an individual lipid, identified as vitamin MK8 (D₃₇=310 J//m², compared to D₃₇=67 J/m² for E. coli irradiated in the presence of DOPC alone). Liposome-mediated protection was dependent on UV₂₅₄ absorbance and not on turbidity-related light-scattering. BOth vitamin MK8 from D. radiodurans and vitamin K₁, which is available commercially, showed a similar degree of UV₂₅₄-protection for E. coli. The UV-protective properties of vitamin K₁ were also investigated on mammalian cells in comparison with other natural lipids and known sunscreens. Survival curves were obtained for mouse fibroblast (L) cells irradiated at UV₂₅₄ in the absence or presence of DOPC liposomes into which were incorporated various natural lipids or standard sunscreen ingredients, all at final concentrations of 1 mg/ml. Experimentally determined values of D₃₇ were as follows: Vitamin K₁, 73 J/m²; \-carotene, 44 J/m₂; -tocopherol, 20 J/m₂; sulisobenzone, 156 J/m²; p-aminobenzoic acid (PABA), 113 J/m²; benzophenone, 80 J/m²; oxybenzone, 61 J/m² and DOPC alone. 23 J/m². Vitamin K₁, the most protective lipid tested, was also compared with PABA and oxybenzone (all at concentrations of 20 mg/ml; applied topicall) for its ability to protec Skh-hairless mice from UV₂₅₄-induced erythema, yielding a UV₂₅₄ protection factor of 3.5. In addition, vitamin K₁ (at 100 mg/ml) was able to provide hairless mice with a small degree of UVB protection, as indicated by an experimentally determined Solar Protection Factor of 1.5–2.0. Although it is concluded that vitamin K is not likely to account for the extraordinarily high degree of UV-resistance of D. radiodurans, vitamin K does show characteristics worthy of its consideration as a UV-screening agent. Offprint requests to: R. Anderson     

Multiple fruiting of the edible mushroomCoprinus cinereus from explants of the stipe

Summary Carpophores were developed on defined medium from explants of stipes produced in the dark using an expansionless mutant (no. 190) ofCoprinus cinereus. Explants taken from stipes within 24 h of formation developed multiple fruit within 3–12 days without formation of mycelia. Fruiting levels were affected by stipe age (24 h), medium composition, explant size, and polarity of the explant on fruiting medium. This method offers a new tool for developmental studies and may also be of use to commercial mushroom growers.