Sex differences in the response of rats to drugs affecting GABAergic transmission

The administration of diazepam 1.0 mg/kg decreased the level of plasma corticosterone in female but not in male Wistar rats. Picrotoxin, another drug affecting GABAergic transmission, also brought about an increase of plasma corticosterone in both sexes. However, in order to achieve a plasma corticosterone increase of similar magnitude (more than 500%) a threefold higher dose of picrotoxin had to be given to males. When the convulsive properties of picrotoxin were tested, it became evident that the dose of picrotoxin (2.5 mg/kg) which was subconvulsive in male was almost 100% convulsive in female rats. The existing sex differences in the response of rats to drugs affecting GABAergic transmission might have possible implications in the treatment of GABA system dysfunction.     

Synthesis and antitumor activity of N-sulfonyl derivatives of nucleobases and sulfonamido nucleoside derivatives

The introduction of sulfonamido group on the C-2 position of pyrimidine nucleosides was achieved by ring opening of 2,2'- and 2,3'-anhydronucleosides. N-sulfonyl derivatives of nucleobases and sulfonamido derivatives of nucleosides were assayed for in vitro antitumor activity.     

Influence of the incoming solar radiation on the bone mineral density in the female adult population in Croatia

The relationship between the bone mineral density (BMD) in Croatian female adults and the average incoming solar radiation at the ground was investigated. The study included 387 volunteers of average age of 60 years from three different towns: Pula (n = 128, age from 35 to 76), Krapina (n = 141, age from 43 to 77), and Zagreb (n = 118, age from 32 to 79). Apart from the different lifestyle, each of above towns is characterized by different incoming solar radiation, where values of 503.3 kJ cm-2, 471.2 kJ cm-2 and 436.3 kJ cm-2 correspond to average annual radiation at the ground for Pula, Krapina and Zagreb, respectively. Heel BMD was measured by clinical bone sonometer (Sahara). On the average the BMD was highest for Pula (0.469 g cm-2) and the lowest for Zagreb (0.433 g cm-2). Similarly, the percentage of normal bones was the highest for Pula (46.1%) and the lowest for Zagreb (32.2%). Osteopenic bones were the most frequent for Zagreb (61.0%), while corresponding figures for Pula and Krapina were 46.9% and 43.6%, respectively. Osteoporosis varied from 6.8% in Zagreb to 11.4% in Krapina. A test of independence by contingency table confirmed at the significance level alpha = 0.05 that probability of normal bone occurrence increases with the increase of incoming solar radiation. Results of the multiple regression analysis suggest the dependence of BMD on woman's age and weight, and incoming solar radiation at the place of habitation.     

Efficacy and safety of propofol sedation during urgent upper gastrointestinal endoscopy--a prospective study

The aim of this study was to investigate both the efficacy and safety of sedation with propofol during urgent therapeutic gastroscopy in patients with upper gastrointestinal bleeding. This prospective study included a total of 110 patients. Propofol was administered intravenously at the starting dose of 1 mg/kg body weight and was followed by repeated doses. Oxygen saturation and heart rate were monitored by pulse oxymetry. The mean dose of propofol administered was 161 +/- 49 mg. Urgent upper GI endoscopy under propofol sedation was successful in 98% of cases. Endoscopists rated the sedation as good in 83.6%, satisfactory in 14.5%, and poor in 1.8% of patients. Potentially harmful drop in oxygen saturation below 85% was observed in 5.5% of patients, whereas a temporary drop in heart rate below 50 beats/min was observed in 11.8%, not requiring any intervention. Almost 93% of patients could not remember the beginning or the end of the intervention. This data demonstrates that sedation with propofol is suitable for use in patients with upper gastrointestinal bleeding undergoing urgent endoscopy.     

Patients' satisfaction with prosthetic devices

The purpose of the paper was to ascertain the factors which affect the satisfaction of patients with the prosthetic therapy. The purpose of the paper was also to ascertain if there are common factors characteristic for patients dissatisfied with the prosthetic therapy although the specialist appraises it as objectively successful. 52 patients of the Clinical Institute for Rehabilitation and Orthopedic Devices were participating in the research, to which, after unsuccessful surgical-prosthetic rehabilitation, reamputation and prosthetic provision was carried out, which was appraised successful by the doctor. It was endeavored to appraise to what extent the appraisal by the doctor corresponds to patient's satisfaction. On the basis of the questionnaire elaborated specifically for this research and the statistical processing, it was concluded that where the doctor appraised the prosthetic therapy as successful, the same opinion was shared by the majority of the patients (92.3%). Patients are similarly satisfied with the function and the esthetic quality of the prosthesis (73%). The reason why 7.7% of patients are dissatisfied in cases when the doctor considers that there are no objective reasons for that should be sought in non-medical factors. The age, the education, the marital status, the income state, the size of the residence and the regional affiliation do not have a significant influence on the satisfaction of patients with the prosthesis (p > 0.05). Patients with a minor handicap achieve satisfaction with the prosthetic therapy faster, as well as the right-handed persons if the prosthesis on the right-hand extremity is in question (p < 0.05). This investigation showed that the responsibility of not wearing prosthetic aids, both orthopedic, and dental prostheses, couldn't be only neuroticism by prosthetic patients, because that connection is not statistically significant (p < 0.09).     

Selective portal vein embolization as introduction in major surgery

In the period between the December 2000 and September 2004, altogether 13 patients underwent preoperative portal vein embolization (PPVE); 9 patients with colorectal metastases and 4 patients with hepatocellular carcinoma. The indirect splenic portography was performed after catheter was introduced into superior mesenteric artery via femoral artery approach. The portal vein was punctured percutaneously transhepatic under fluoroscopy. Following portography, selected portal vein segments were embolized by injecting polyvinil alcohol (PVA) particles until stasis of blood flow was achieved. Proximal parts of branches and the channel in the liver parenchyma were occluded with Gelfoam particles. The increase of the remnant liver parenchyma was measured by magnetic resonance imaging. iTwo patients experienced post-embolization syndrome and another one had subcapsular hematoma. The volume of the liver parenchyma increased minimally for 8% and maximally for 109%. Altogether, 10 patients underwent surgical resection. In two patients, the disease progressed and carcinoma spread to the previously healthy liver lobe and in one there was no hypertrophy and we decided for artery chemoembolization (AC). The results show that PPVE triggers a strong regenerative response resulting in hypertrophy of normal liver parenchyma and expand possibilities of curative surgery for patients who would not otherwise have been candidates for extended resection.     

Testing the phylogenetic position of a parasitic plant (Cuscuta, Convolvulaceae, asteridae): Bayesian inference and the parametric bootstrap on data drawn from three genomes

Previous findings on structural rearrangements in the chloroplast genome of Cuscuta (dodder), the only parasitic genus in the morning-glory family, Convolvulaceae, were attributed to its parasitic life style, but without proper comparison to related nonparasitic members of the family. Before molecular evolutionary questions regarding genome evolution can be answered, the phylogenetic problems within the family need to be resolved. However, the phylogenetic position of parasitic angiosperms and their precise relationship to nonparasitic relatives are difficult to infer. Problems are encountered with both morphological and molecular evidence. Molecular data have been used in numerous studies to elucidate relationships of parasitic taxa, despite accelerated rates of sequence evolution. To address the question of the position of the genus Cuscuta within Convolvulaceae, we generated a new molecular data set consisting of mitochondrial (atpA) and nuclear (RPB2) genes, and analyzed these data together with an existing chloroplast data matrix (rbcL, atpB, trnL-F, and psbE-J), to which an additional chloroplast gene (rpl2) was added. This data set was analyzed with an array of phylogenetic methods, including Bayesian analysis, maximum likelihood, and maximum parsimony. Further exploration of data was done by using methods of phylogeny hypothesis testing. At least two nonparasitic lineages are shown to diverge within the Convolvulaceae before Cuscuta. However, the exact sister group of Cuscuta could not be ascertained, even though many alternatives were rejected with confidence. Caution is therefore warranted when interpreting the causes of molecular evolution in Cuscuta. Detailed comparisons with nonparasitic Convolvulaceae are necessary before firm conclusions can be reached regarding the effects of the parasitic mode of life on patterns of molecular evolution in Cuscuta.     

Possible apoptotic mechanism in epidermal cell acantholysis induced by pemphigus vulgaris autoimmunoglobulins

Through a still unclear mechanism, pemphigus vulgaris autoantibodies (PV-IgG) induce intra-epidermal acantholytic lesions responsible for severe to fatal skin wounding. We present evidence that PV lesions contain apoptotic keratinocytes, and that cell death is induced in the lesional tissue apparently before cell separation. These data suggest that apoptosis could be the cause of the acantholytic phenomenon. We show that PV-IgG and an antibody against Fas receptor (anti-FasR) induce lesions in vitro in a similar way, causing: (1) secretion of soluble FasL; (2) elevated cellular amounts of FasR, FasL (soluble and membranal), Bax and p53 proteins; (3) reduction in levels of cellular Bcl-2; (4) enrichment in caspase 8, and activation of caspases 1 and 3; (5) co-aggregation of FasL and FasR with caspase 8 in membranal death-inducing signaling complex (DISC). Hence, the Fas-mediated death signaling pathway seems to be involved in lesion formation. Moreover, we have shown that in skin organ cultures and in keratinocyte cultures, PV-IgG can induce caspase activation and DNA fragmentation, and caspase inhibitors can prevent the formation of PV-IgG-induced epidermal lesions. Altogether, these results suggest that PV-IgG-induced acantholysis may proceed through the death-signaling pathway. They highlight new perspectives on mechanisms of tissue damage in autoimmune diseases.     

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.     

Development of cytotrophoblast columns from explanted first-trimester human placental villi: role of fibronectin and integrin alpha5beta1

Human first-trimester floating mesenchymal villi explanted onto gels of collagen I or Matrigel were observed to undergo de novo development of anchoring sites. These consisted of cytotrophoblast columns that formed by proliferation of stem villous cytotrophoblast cells, as revealed by whole-mount and thin-section microscopy and incorporation of bromodeoxyuridine into DNA. Column formation occurred exclusively at the distal tips of the villi. No column formation was observed in tissue explanted onto agarose. On Matrigel, the developing columns penetrated downwards into the matrix, whereas on collagen I, cytotrophoblast sheets spread across the surface of the gel and merged to form a shell. The developing columnar cytotrophoblast up-regulated integrins alpha1beta1 and alpha5beta1 and produced an extracellular matrix containing oncofetal fibronectin, as in vivo. Function-blocking antibodies were used to investigate the role of the integrin-fibronectin interaction in anchoring villus development on collagen I. Antibodies to fibronectin and the integrin subunits alpha5 and beta1, added at 24 h, all changed the pattern of cytotrophoblast outgrowth. Anti-fibronectin caused cell rounding within the cytotrophoblast sheet and increased the population of single cells at its periphery. Anti-integrin alpha5 caused rounding and redistribution of cells within the outgrowth. In the presence of anti-integrin beta1, cell-collagen interactions within the sheet were destabilized, often leading to the appearance of an annulus of aggregated cells at the periphery. These results show that 1) mesenchymal villi retain the potential to form anchoring sites until at least the end of the first trimester, 2) adhesion to a permissive extracellular matrix stimulates cytotrophoblast proliferation and differentiation along the extravillous lineage, 3) integrin alpha5beta1-fibronectin interactions contribute significantly to anchorage of the placenta to uterine extracellular matrix. We suggest that as the developing placenta ramifies, new sites of anchorage form whenever peripheral villi contact decidua. This process is predicted to contribute to the stability of the placental-decidual interface.