Chromosomal location of isozyme and seed storage protein genes in Dasypyrum villosum (L.) Candargy

Summary The zymogram phenotypes of glucose-phosphate isomerase (GPI), alcohol dehydrogenase-1 (ADH-1), glutamate oxaloacetate transaminase (GOT), superoxide dismutase (SOD), lipoxygenase (LPX), esterase (EST) and the banding patterns of gliadin and glutenin seed storage proteins were determined for Triticum aestivum cv. Chinese Spring (CS), Dasypyrum villosum, the octoploid amphiploid T. aestivum cv. Chinese Spring D. villosum (CS × v) (2n=8x=56; AABBDDVV), and for five CS-D. villosum disomic addition lines. The genes Gpi-V1, Adh-V1, Got-V2, and Sod-V2 coding for GPI-1, ADH-1, GOT-2, and SOD-2 isozymes were located in D. villosum on chromosome 1V, 4V, 6V, and 7V, respectively. Genes coding for gliadin- and glutenin-like subunits are located in D. villosum chromosomes 1V. There are no direct evidence for chromosomal location of genes coding for GOT-3, EST-1 and LPX-2 isozymes. The linkage between genes coding for glutenin-like proteins and GPI-1 isozymes in chromosome 1V is evidence of homoeology between chromosome 1V and the chromosomes of homoeologous group 1 in wheat.Research supported by the National Research Council (Italy) and National Science Foundation (USA). International cooperative project, Grant No. 85.01504.06 (CNR)     

Stressful life events preceding the acute onset of schizophrenia: A cross-national study from the World Health Organization

This study reports on the findings from a WHO sponsored cross-national investigation of life events and schizophrenia. Data are presented from a series of 386 acutely ill schizophrenic patients selected from nine field research centers located in developing and developed countries (Aarhus, Denmark; Agra, India; Cali, Colombia; Chandigarh, India; Honolulu, USA; Ibadan, Nigeria; Nagasaki, Japan; Prague, Czechoslovakia; Rochester, USA). On a methodological level, the study demonstrates that life event methodologies originating in the developed countries can be adapted for international studies and may be used to collect reasonably reliable and comparable cross-cultural data on psychosocial factors affecting the course of schizophrenic disorders. Substantive findings replicate the results of prior studies which conclude that socioenvironmental stressors may precipitate schizophrenic attacks and such events tend to cluster in the two to three week period immediately preceding illness onset.The paper was prepared by these authors on behalf of the collaborating investigators listed on page 196.     

Sequence specificity of DNA topoisomerase I in the presence and absence of camptothecin.

Previously, we have demonstrated that in Tetrahymena DNA topoisomerase I has a strong preference in situ for a hexadecameric sequence motif AAGACTTAGAAGAAAAAATTT present in the non-transcribed spacers of r-chromatin. Here we characterize more extensively the interaction of purified topoisomerase I with specific hexadecameric sequences in cloned DNA. Treatment of topoisomerase I-DNA complexes with strong protein denaturants results in single strand breaks and covalent linkage of DNA to the 3' end of the broken strand. By mapping the position of the resulting nicks, we have analysed the sequence-specific interaction of topoisomerase I with the DNA. The experiments demonstrate that: the enzyme cleaves specifically between the sixth and seventh bases in the hexadecameric sequence; a single base substitution in the recognition sequence may reduce the cleavage extent by 95%; the sequence specific cleavage is stimulated 8-fold by divalent cations; 30% of the DNA molecules are cleaved at the hexadecameric sequence while no other cleavages can be detected in the 1.6-kb fragment investigated; the sequence specific cleavage is increased 2- to 3-fold in the presence of the antitumor drug camptothecin; at high concentrations of topoisomerase I, the cleavage pattern is altered by camptothecin; the equilibrium dissociation constant for interaction of topoisomerase I and the hexadecameric sequence can be estimated as approximately 10(-10) M.     

Effect of dietary boron on mineral, estrogen, and testosterone metabolism in postmenopausal women

A study was done to examine the effects of aluminum, magnesium, and boron on major mineral metabolism in postmenopausal women. This communication describes some of the effects of dietary boron on 12 women between the ages of 48 and 82 housed in a metabolic unit. A boron supplement of 3 mg/day markedly affected several indices of mineral metabolism of seven women consuming a low-magnesium diet and five women consuming a diet adequate in magnesium; the women had consumed a conventional diet supplying about 0.25 mg boron/day for 119 days. Boron supplementation markedly reduced the urinary excretion of calcium and magnesium; the depression seemed more marked when dietary magnesium was low. Boron supplementation depressed the urinary excretion of phosphorus by the low-magnesium, but not by the adequate-magnesium, women. Boron supplementation markedly elevated the serum concentrations of 17 beta-estradiol and testosterone; the elevation seemed more marked when dietary magnesium was low. Neither high dietary aluminum (1000 mg/day) nor an interaction between boron and aluminum affected the variables presented. The findings suggest that supplementation of a low-boron diet with an amount of boron commonly found in diets high in fruits and vegetables induces changes in postmenopausal women consistent with the prevention of calcium loss and bone demineralization.     

Simultaneous demonstration of two antigens in ultrathin cryosections by a novel application of an immunogold staining method using primary antibodies from the same species

A recently developed immunocytochemical double-staining method for ultrathin Epon and Lowicryl K4M sections has been adopted for use on ultrathin cryosections. The essential features of the method include: staining for the first antigen by the indirect method using sufficient concentrations of second antibodies conjugated to colloidal gold particles to saturate available epitopes on the primary antibodies; supporting the cryosections by methyl cellulose followed by paraformaldehyde vapour treatment (30-60 min at 80 degrees C); removal of the methyl cellulose followed by staining for the second antigen using primary antiserum from the same species and another size class of colloidal gold particles conjugated to second antibodies. Contaminating staining does not occur if the paraformaldehyde vapour treatment exceeds 30 min, as this treatment destroys the combining sites on the second antibodies applied in the first staining cycle. Successful double-staining was documented using primary rabbit antibodies to growth hormone and corticotropin and anti-rabbit IgG conjugated to 5 and 15 nm colloidal gold particles. Following double-staining, the ultrathin cryosections may be silver-enhanced to improve detectability of the markers at low magnification.     

Posttreatment with sodium arsenite is coclastogenic in log phase but not in stationary phase

Summary Posttreatment with sodium arsenite in log phase synergistically increases the chromosomal aberrations induced by ethyl methanesulfonate in Chinese hamster ovary cells, human fibroblasts, and human lymphocytes. However, posttreatment with sodium arsenite in stationary phase has no apparent effect on the clastogenicity of ethyl methanesulfonate. These results indicate that the cycling state of the cell plays a crucial role in the action of arsenite coclastogenicity. One prediction from this finding is that in combined treatment, posttreatment with sodium arsenite should preferentially kill cancer cells.     

Expression of HLA-DR antigens on tumour cells does not contribute to skin reactivity to autologous cholesteryl hemisuccinate (CHS)-treated tumour cells in patients with metastatic melanoma

Summary Skin tests with autologous cholesteryl hemisuccinate (CHS)-treated and untreated cells were performed in ten metastatic melanoma patients. In the majority of cases evident reaction was noted with CHS-treated cells (9/10) while the reaction with untreated cells was mostly negative (7/10). Tumour cell suspensions used for skin tests were characterized for reactivity with monoclonal antibody TAL 1B5 detecting the HLA-DR alpha chain. There were no differences between CHS-treated and untreated cells with respect to HLA-DR expression and no correlation was found between grade of skin reaction to CHS-treated cells and the proportion of HLA-DR positive cells in the injected cell sample.