Inhibition of acrosin by oviductal secretory immunoglobulin A

A major inhibitor of acrosin in rhesus monkey and rabbit oviduct fluid, isolated by isoelectrofocusing in sucrose gradients, displayed a broad peak in the acidic region of the column and was demonstrated to contain secretory IgA specific for acrosin. Its identity was established by immunodiffusion, by the removal of acrosin inhibition with antisera to IgA (α-chain), and by its correct molecular weight during ultracentrifugation. Purified human serum IgA also inhibited rabbit, rhesus monkey, and human acrosins, but neither purified human IgG nor IgM had any inhibitory effect on these acrosins. Neither oviduct fluid secretory IgA nor purified human serum IgA inhibited the activity of bovine pancreatic trypsin. The high specificity of secretory IgA for acrosin and its presence in every rabbit and rhesus monkey oviduct fluid specimen examined suggests a possible regulatory role for this antibody in reproduction.     

Aminoacid composition and hydrophobicity index of mitochondrial polypeptides

The aminoacid composition of protein stained bands in polyacrylamide gels, after electrophoresis of proteins from inner mitochondrial membranes, was investigated hydrolyzing directly the gel slices. The Hydrophobicity Index of 18 prominent polypeptide bands was calculated after their aminoacid analysis. The polypeptides less related to the membrane have low hydrophobicity as inferred from their Hydrophobicity Indexes.     

Immunochemical characteristics of the peroxidases of several mouse tissues]

Enzymes catalyzing peroxidase reaction of a lysosomal fraction in bone marrow, leucocytes, spleen, thyroid gland, stomach, kidney, heart, lungs, brain and skeletal muscle of mice were investigated by immunochemical methods. A high level of peroxidase activity was discovered in leucocytes, bone marrow, spleen, heart and lung, a lower activity appeared to be characteristic of liver, thyroid gland and kidney. The peroxidase activities in brain, skeletal muscle and stomach were low. The reaction of immunoprecipitation with myeloperoxidase-specific antiserum revealed considerable antigenic distinctions between the enzymes catalysing peroxidase reaction in various tissues of mice.     

Protein-lipid interactions and differential scanning calorimetric studies of bacteriorhodopsin reconstituted lipid-water systems

Bacteriorhodopsin has been reconstituted at various molar concentrations into liposomes of dimyristoyl- and also of dipalmitoylphosphatidylcholine. Differential scanning calorimetry indicates that as the protein concentration within the lipid bilayer increases, the cooperativity of the lipid phase transition is reduced, i.e. the transition is broadened, while the midpoint transition temperature remains virtually unchanged. Freeze-fracture electron microscopy of our preparation shows, in agreement with previous data from other laboratories, that extensive protein aggregation occurs when the liposome is cooled below the T_c transition temperature of the lipid. Laser flash photolysis measurements of protein rotation of the bacteriorhodopsin show, especially in the case of protein-rich recombinants, that protein aggregates exist even above T_c. The perturbation caused by the presence of bacteriorhodopsin in the lipid bilayer is similar to that produced by other intrinsic proteins. The difficulty of correlating the observed calorimetric enthalpy data with a simple concept of a ‘boundary lipid layer’ based upon consideration of a single isolated protein is discussed in view of the occurrence of protein aggregates both above and below T_c. It is concluded that the reduction of enthalpy is related to the number of lipids which solvate the protein aggregates within the protein-lipid patches and are thereby removed from the cooperative melting and enthalpy of the remaining regions of pure lipid.     

The primary structure of the Fab fragment of protein KAU, a monoclonal immunoglobulin M cold agglutinin

The complete amino acid sequence of the Fab fragment of protein KAU, a human monoclonal cold agglutinin (IgMk) with anti-I activity, was determined. The light chain (L-chain) consists of 215 residues; the variable (V)L region belongs to the Hum/Kv325/kIIIb sub-subgroup that is preferentially selected in human IgM autoimmune response. The joining (J) region is encoded by the Jk4 gene, and the constant region (C)L domain expresses the km3 allotypic marker. The Fd fragment contains 232 amino acids, and 120 of them comprise the variable domain. The VH region corresponds to the VHIV subgroup and is closely related to the VHIV 2.1 gene isolated from genomic DNA expressed in peripheral blood of a healthy Caucasian. The complementary-determining region 1 has a unique amino acid (Asp) at position 31, and the complementary-determining region 3 codified by the diversity segment (D) gene, shows poor homology with other known D sequences. The joining segment with two unusual substitutions at the D-J junction is encoded by the JH4 gene. Thus, cold agglutinin KAU is an IgM, VkIIIb-Jk4-km3; VHIV-JH4-C mu.     

Interleukin-4 enhances anti-IgM stimulation of B cells by improving cell viability and by increasing the sensitivity of B cells to the anti-IgM signal

The lymphokine IL-4 is a potent enhancer of anti-IgM-induced B cell proliferation. Although the mechanism of this enhancement is not known, a commonly held view suggests that IL-4 acts together with anti-IgM as a costimulating factor for the activation of a subpopulation of B cells. To evaluate this hypothesis we examined the effect of IL-4 on the proportion of B cells stimulated to divide by different doses of anti-IgM using flow cytometry in combination with measurements of tritiated-thymidine incorporation. The results suggest a novel and surprisingly simple model for the mode of action of IL-4. Our analysis revealed that at high saturating anti-IgM concentrations, the proportion of live B cells which enter into S phase of the cell cycle is the same (approximately 65%) for cells cultured with or without IL-4. Cultures containing IL-4, however, exhibit a twofold increase in thymidine uptake over cultures without IL-4. This increase can be explained completely by the ability of IL-4 to enhance the viability of small dense B cells over the first 24 hr from approximately 50 to 90% of the starting cell number. Normalizing the maximum response levels obtained with and without IL-4 reveals that B cells incubated with IL-4 exhibit a 10-fold decrease in the concentration of anti-IgM required to stimulate the half-maximum proliferation level. Furthermore, evaluation of the number of cells in S phase by flow cytometry and analysis of the kinetics of cell proliferation revealed that the increased response effected by IL-4 at lower anti-IgM concentrations was due to a greater number of proliferating B cells rather than the same number of cells undergoing a faster division rate. We also found a highly nonlinear relationship between B cell number and proliferative response, implying a requirement for an additional, cell cooperation-mediated, activating signal for maximum B cell proliferation. IL-4 enhanced proliferation by the same proportion at all cell concentrations indicating that it does not replace or alter this requirement for cell cooperation. Taken together these results suggest that anti-IgM in combination with a second unidentified cell-cooperation-dependent signal leads to proliferation of up to 65% of small resting B cells. IL-4 does not provide an essential activation signal but serves to raise the sensitivity of B cells to the anti-IgM-generated signal.(ABSTRACT TRUNCATED AT 400 WORDS)     

Chromosome banding study of the golden loach,Sabanejewia aurata balcanica from Slovakia (Cobitidae)

The karyotype of a subspecies of the golden loach,Sabanejewia aurata balcanica from eastern Slovakia was studied by conventional Giemsa staining, Ag-NOR staining, and C-banding. The diploid chromosome number was 2n = 50. The karyotype comprised 2 pairs of metacentric, 6 pairs of submetacentric and 17 pairs of subtelocentric to acrocentric chromosomes. Both metacentric pairs and 2 large subtelocentric pairs had massive pericentromeric blocks, while all other elements had only weak blocks of heterochromatin. The NORs were localized on the short arms of one middle-sized subtelocentric pair. The karyotype ofS. a. balcanica differs from that ofS. aurata kubanica, suggesting chromosomal polymorphism of this widely distributed, polytypic cobitid species. The polymorphic karyotypes of the golden loach may thus demonstrate transient stages, linking primitive and advanced cobitid karyotypes.     

Substrate specificity of phospholipase B from guinea pig intestine. A glycerol ester lipase with broad specificity.

The substrate specificity of a calcium-independent, 97-kDa phospholipase B purified from guinea pig intestine was further investigated using various natural and synthetic lipids. The enzyme was equally active toward enantiomeric phosphatidylcholines under conditions allowing a strict phospholipase A activity. The lysophospholipase activity declined with the following substrates: 1-acyl-sn-glycero-3-phosphocholine greater than 1-palmitoyl-propanediol-3-phosphocholine greater than 1-palmitoyl-glycol-2-phosphocholine, suggesting some influence of the polar residue vicinal to the cleavage site. The enzyme also acted on various neutral lipids including triacylglycerol, diacylglycerol, and monoacylglycerol, whereas cholesteryl oleate remained refractory to enzymatic hydrolysis. The lipase hydrolyzed sequentially the sn-2 and sn-1 acyl ester bonds of diacylglycerol, although some direct cleavage of the external acyl ester bond could also occur, as shown with diacylglycerol analogues bearing a nonhydrolyzable alkyl ether or amide bond in the sn-1 or sn-2 position. The three main activities of the enzyme (phospholipase A2, lysophospholipase, and diacylglycerol lipase) were resistant to 4-bromophenacyl bromide, but they were inhibited by N-ethylmaleimide, 5,5'-dithiobis-(2-nitrobenzoic acid), and diisopropyl fluorophosphate, suggesting the possible involvement of both cysteine and serine residues in a single active site. It is concluded that guinea pig intestinal phospholipase B, which was also detected in rat and rabbit, is actually a glycerol ester lipase with broad substrate specificity and some unique enzymatic properties.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Helix-forming tendencies of amino acids depend on the restrictions of side-chain rotamer conformations: crystal structure of the tripeptide GAI in two crystalline forms.

In our attempts to design crystalline alpha-helical peptides, we synthesized and crystallized GAI (C11H21N3O4) in two crystal forms, GAI1 and GAI2. Form 1 (GAI1) Gly-L-Ala-L-Ile (C11H21N3O4.3H2O) crystals are monoclinic, space group P2(1) with a = 8.171(2), b = 6.072(4), c = 16.443(4) A, beta = 101.24(2) degrees, V = 800 A3, Dc = 1.300 g cm-3 and Z = 2, R = 0.081 for 482 reflections. Form 2 (GAI2) Gly-L-Ala-L-Ile (C11H21N3O4.1/2H2O) is triclinic, space group P1 with a = 5.830(1), b = 8.832(2), c = 15.008(2) A, alpha = 102.88(1), beta = 101.16(2), gamma = 70.72(2) degrees, V = 705 A3, Z = 2, Dc = 1.264 g cm-3, R = 0.04 for 2582 reflections. GAI1 is isomorphous with GAV and forms a helix, whereas GAI2 does not. In GAI1, the tripeptide molecule is held in a near helical conformation by a water molecule that bridges the NH3+ and COO- groups, and acts as the fourth residue needed to complete the turn by forming two hydrogen bonds. Two other water molecules form intermolecular hydrogen bonds in stabilizing the helical structure so that the end result is a column of molecules that looks like an incipient alpha-helix. GAI2 imitates a cyclic peptide and traps a water molecule. The conformation angles chi 11 and chi 12 for the side chain are (-63.7 degrees, 171.1 degrees) for the helical GAI1, and (-65.1 degrees, 58.6 degrees) and (-65.0 degrees, 58.9 degrees) for the two independent nonhelical molecules in GAI2; in GAI1, both the C gamma atoms point away from the helix, whereas in GAI2 the C gamma atom with the g+ conformation points inward to the helix and causes sterical interaction with atoms in the adjacent peptide plane. From these results, it is clear that the helix-forming tendencies of amino acids correlate with the restrictions of side-chain rotamer conformations. Both the peptide units in GAI1 are trans and show significant deviation from planarity [omega 1 = -168(1) degrees; omega 2 = -171(1) degrees] whereas both the peptide units in both the molecules A and B in GAI2 do not show significant deviation from planarity [omega 1 = 179.3(3) degrees; omega 2 = -179.3(3) degrees for molecule A and omega 1 = 179.5(3) degrees; omega 2 = -179.4(3) degrees for molecule B], indicating that the peptide planes in these incipient alpha-helical peptides are considerably bent.