Dramatic effect of single-base mutation on the conformational dynamics of human telomeric G-quadruplex

Guanine-rich DNA sequences can form G-quadruplexes. These four-stranded structures are known to form in several genomic regions and to influence certain biological activities. Sometimes, the instability of G-quadruplexes causes the abnormal biological processes. Mutation is a culprit for the destabilization of G-quadruplexes, but the details of mutated G-quadruplexes are poorly understood. In this article, we investigated the conformational dynamics of single-base mutated human telomeric G-quadruplexes in the presence of K⁺ with single-molecule FRET spectroscopy. We observed that the replacement of single guanine by thymine in a G-track induces various folded structures, i.e. structural polymorphism. Moreover, direct observation of their dynamics revealed that a single-base mutation causes fast unfolding of folded states under physiological conditions. Furthermore, we found that the degree of destabilization varies according to mutation positions. When the central guanine of a G-track is replaced, the G-quadruplexes unfold quickly at any K⁺ concentrations and temperature. Meanwhile, outer-quartet mutated G-quadruplexes have heterogeneous dynamics at intermediate K⁺ concentrations and longstanding folded states at high K⁺ concentrations. Several factors such as base-stacking interaction and K⁺ coordination are responsible for the different dynamics according to the mutation position.     

Ethanol production from rice straw using optimized aqueous-ammonia soaking pretreatment and simultaneous saccharification and fermentation processes

Rice straw was pretreated using aqueous-ammonia solution at moderate temperatures to enable production of the maximum amount of fermentable sugars from enzymatic hydrolysis. The effects of various operating variables including pretreatment temperature, pretreatment time, the concentration of ammonia and the solid-to-liquid ratio on the degree of lignin removal and the enzymatic digestibility were optimized using response surface methodology. The optimal reaction conditions, which resulted in an enzymatic digestibility of 71.1%, were found to be 69 °C, 10 h and an ammonia concentration of 21% (w/w). The effects of different commercial cellulases and the additional effect of a non-cellulolytic enzyme, xylanase, were also evaluated. Additionally, simultaneous saccharification and fermentation was conducted with rice straw to assess the ethanol production yield and productivity.     

Geographical Distribution and Relative Abundance of Vectors of Scrub Typhus in the Republic of Korea

A survey to determine the geographical distribution and relative abundance of potential vectors of scrub typhus was conducted from October to November 2006 at 13 localities throughout the Republic of Korea. Apodemus agrarius accounted for 97.6% (80/82) of all rodents, while only 2 Myodes regulus (2/82) were collected. A total of 10,860 chiggers were collected from A. agrarius belonging to 4 genera and 8 species, while only Walchia fragilis (40) was collected from Myodes regulus. Leptotrombidium pallidum (8,137; 74.9%), a vector of scrub typhus, was the predominant species collected from A. agrarius followed by Leptotrombidium scutellare (2,057, 18.9%), Leptotrombidium palpale (279; 2.7%), Leptotrombidium orientale (232; 2.1%), and Leptotrombidium zetum (79; 0.7%), Neotrombicula tamiyai (58; 0.5%), Euschoengastica koreaensis (16; 0.1%), and Cheladonta ikaoensis (2; < 0.1%). L. pallidum was the predominant chigger collected at collection sites in Gangwon (100%), Gyeonggi (87.2%), Chungnam (100%), Chungbuk (100%), Jeonbuk (73.9%), Jeonnam (77.0%), and Gyeongbuk (66.1%) provinces, whereas L. scutellare was the predominant chigger collected in Gyeongnam province (77.9%) and Jeju Island (62.3%). Data suggest a correlation between chigger population abundance and human cases of scrub typhus in Korea.     

Preventive effect of piperonyl butoxide on cyclophosphamide-induced teratogenesis in rats

BACKGROUND: Cyclophosphamide induces fetal defects through metabolic activation by cytochrome P-450 monooxygenases (CYP). The effects of piperonyl butoxide (PBO), a CYP inhibitor, on the fetal development and external, visceral, and skeletal abnormalities induced by cyclophosphamide were investigated in rats. METHODS: Pregnant rats were daily administered PBO (400 mg/kg) by gavage for 7 days (the 6th to 12th day of gestation), and intraperitoneally administered with cyclophosphamide (12 mg/kg) 4 h after the final treatment. On the 20th day of gestation, maternal and fetal abnormalities were determined by Cesarean section. RESULTS: Cyclophosphamide reduced fetal body weights by 30–40% without increasing resorption or death. In addition, it induced malformations in live fetuses: 100, 98, and 98.2% of the external (head and limb defects), visceral (cerebroventricular dilatation, cleft palate, and renal pelvic/ureteric dilatation), and skeletal (acrania, vertebral/costal malformations, and delayed ossification) abnormalities, respectively. The pre-treatment of PBO greatly decreased mRNA expression and activity of hepatic CYP2B, which metabolizes cyclophosphamide into teratogenic acrolein and cytotoxic phosphoramide mustard. Moreover, PBO remarkably attenuated cyclophosphamide-induced body weight loss and abnormalities of fetuses; score 3.57 versus 1.87 for exencephaly, 75.5% versus 42.5% for limb defects, 65.3% versus 22% for cerebroventricular dilatation, 59.2% versus 5.1% for cleft palate, score 1.28 versus 0.93 for renal pelvic/ureteric dilatation, 71.9–82.5% versus 23–45.9% for vertebral/costal malformations, and 84.2% versus 57.4% for delayed ossification in cyclophosphamide alone and PBO co-administration groups. CONCLUSIONS: These results suggest that repeated treatment with PBO may improve cyclophosphamide-induced body weight loss and malformations of fetuses by down-regulating CYP2B. Birth Defects Res (Part B) 86:402–408, 2009. © 2009 Wiley-Liss, Inc.     

Digestion-resistant fraction from soybean [Glycine max (L.) Merrill] induces hepatic LDL receptor and CYP7A1 expression in apolipoprotein E-deficient mice

Soybean [Glycine max (L.) Merrill] is known to have hypocholesterolemic effects; however, the function and mechanism of its digestion-resistant fraction (RF) in cholesterol reduction is not clearly understood. In the present study, we investigated the hypocholesterolemic effects of the RF from soybean in C57BL/6J and apolipoprotein E (apoE)-deficient mice. RFs were prepared either from raw or preheated crops to measure compositional changes in RF during cooking. Preheating reduced the RF yields and the resistant starch (RS) fraction in RF. After 1 week of feeding, the raw soybean RF (5%, w/w) was the most effective in lowering plasma cholesterol concentrations by 27% (P<.05) in apoE-deficient (apoE-/-) mice. A smaller but significant reduction was found in C57BL/6J mice. The RF from preheated soybean tended to have lower hypocholesterolemic effects than did the RF from raw soybean in apoE-/- mice. This suggests the RS may be a key hypocholesterolemic component from soybean RF. RF consumption (5%, w/w) dramatically increased hepatic low-density lipoprotein receptor and cholesterol 7alpha-hydroxylase expression in both apoE-/- and C57BL/6J mice followed by increased bile acid excretion. 3-Hydroxy-3-methylglutaryl-coenzyme A reductase was only marginally altered. Our results show that the RF, especially from raw soybean containing high level of RS, significantly reduces plasma cholesterol concentrations under hyperlipidemic condition. The cholesterol was reduced by multiple mechanisms such as increased hepatic cholesterol uptake, cholesterol degradation into bile acids and bile acid excretion.     

The critical role played by endotoxin-induced liver autophagy in the maintenance of lipid metabolism during sepsis

Macroautophagy/autophagy is a central mechanism by which cells maintain integrity and homeostasis, and endotoxin-induced autophagy plays important roles in innate immunity. Although TLR4 stimulation mediated by lipopolysaccharide (LPS) also upregulates autophagy in hepatocytes and liver, its physiological role remains elusive. The objective of this study was to determine the role of LPS-induced autophagy in the regulation of liver lipid metabolism. LPS treatment (5 mg/kg) increased autophagy, as detected by LC3 conversion and transmission electron microscopy (TEM) analysis in C57BL6 mouse livers. AC2F hepatocytes also showed increased autophagic flux after LPS treatment (1 μg/ml). To investigate the role of LPS-induced autophagy further, liver lipid metabolism changes in LPS-treated mice and fasted controls were compared. Interestingly, LPS-treated mice showed less lipid accumulation in liver than fasted mice despite increased fatty acid uptake and lipid synthesis-associated genes. In vitro analysis using AC2F hepatocytes demonstrated LPS-induced autophagy influenced the degradation of lipid droplets. Inhibition of LPS-induced autophagy using bafilomycin A₁ or Atg7 knockdown significantly increased lipid accumulation in AC2F hepatocytes. In addition, pretreatment with chloroquine aggravated LPS-induced lipid accumulation and inflammation in C57BL6 mouse livers. The physiological importance of autophagy was verified in LPS-treated young and aged rats. Autophagic response was diminished in LPS-treated aged rats and lipid metabolism was impaired during sepsis, indicating autophagy response is important for regulating lipid metabolism after endotoxin challenge. Our findings demonstrate endotoxin-induced autophagy is important for the regulation of lipid metabolism, and suggest that autophagy helps maintain lipid metabolism homeostasis during sepsis.     

Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer

A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (K_d [kanamycin] = 78.8 nM, K_d [kanamycin B] = 84.5 nM, and K_d [tobramycin] = 103 nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25 nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.     

Genetically engineered microbial biosensors for in situ monitoring of environmental pollution

Microbial biosensors are compact, portable, cost effective, and simple to use, making them seem eminently suitable for the in situ monitoring of environmental pollution. One promising approach for such applications is the fusion of reporter genes with regulatory genes that are dose-dependently responsive to the target chemicals or physiological signals. Their biosensor capabilities, such as target range and sensitivity, could be improved by modification of regulatory genes. Recent uses of such genetically engineered microbial biosensors include the development of portable biosensor kits and high-throughput cell arrays on chips, optic fibers, or other platforms for on-site and on-line monitoring of environmental pollution. This mini-review discusses recent advances in microbial biosensors and their future prospects, with a focus on the development and application of genetically modified microbial biosensors for in situ environmental monitoring.     

Biphasic regulation of tissue plasminogen activator activity in ischemic rat brain and in cultured neural cells: essential role of astrocyte-derived plasminogen activator inhibitor-1

In brain, the serine protease tissue plasminogen activator (tPA) and its endogenous inhibitor plasminogen activator inhibitor-1 (PAI-1) have been implicated in the regulation of various neurophysiological and pathological responses. In this study, we investigated the differential role of neurons and astrocytes in the regulation of tPA/PAI-1 activity in ischemic brain. The activity of tPA peaked transiently and then decreased in cortex and striatum along with delayed induction of PAI-1 in the inflammatory stage after MCAO/reperfusion injury. In cultured primary cells, glutamate stimulation increased tPA activity in neurons but not in other cells such as microglia and astrocytes. With LPS stimulation, a model of neuroinflammatory insults, robust PAI-1 induction was observed in astrocytes but not in neurons and microglia. The upregulation of PAI-1 by LPS in astrocytes was also verified by RT-PCR analysis as well as PAI-1 promoter reporter assay. Lastly, we checked the effects of hypoxia on tPA/PAI-1 activity. Hypoxia increased tPA release from neurons without effects on microglia, while the activity of tPA in astrocyte was decreased consistent with increased PAI-1 activity in astrocyte. Taken together, the results from the present study suggest that neurons are the major source of tPA and that the glutamate-induced stimulated release is mainly governed by neurons in the acute phase. In contrast, the massive up-regulation of PAI-1 in astrocytes during subchronic and chronic inflammatory conditions, leads to decreased tPA activity in the later stages of MCAO. Differential regulation of tPA and PAI-1 in neurons, astrocytes and microglia suggest more attention is required to understand the role of local tPA activity in the vicinity of individual cell types.