pTONA5: a hyperexpression vector in Streptomycetes

We constructed the Streptomyces hyperexpression vector pTONA5 based on pIJ702 vector; it includes a metalloendopeptidase (SSMP) promoter isolated from Streptomyces cinnamoneus TH-2 and a metalloendopeptidase terminator isolated from Streptomyces aureofaciens TH-3. The vector contains recognition sites for restriction enzymes NdeI and EcoRI/XbaI/HindIII between the promoter and terminator to facilitate heterologous gene cloning. The plasmids were transferred from Escherichia coli to streptomycetes via conjugation from oriT; the transformants were able to be selected using kanamycin and/or thiostrepton. The SSMP promoter functions constitutively in the presence of a rich inorganic phosphate source and glucose. We constructed expression plasmids including three Streptomyces aminopeptidases—leucine aminopeptidase, proline aminopeptidase (PAP), and aminopeptidase P (APP)—using the pTONA5 vector and Streptomyces lividans. Although they lack signal peptides for secretion, PAP and APP were secreted at high levels in the culture broth.     

Urocortin in human placenta and maternal plasma.

Plasma immunoreactive (IR-) urocortin (Ucn) and corticotropin-releasing factor (CRF) levels in pregnant women were measured by their specific radioimmunoassays after extraction. Although plasma IR-CRF levels were increased in pregnant women as compared to men and non-pregnant women, there was no difference of plasma IR-Ucn levels among groups. Ucn mRNA was detected in cytotrophoblasts and syncytiotrophoblasts by in situ hybridization. A reverse-phase high-performance liquid chromatography (HPLC) showed the major peak of IR-Ucn in placenta and plasma that had similar chromatographic mobility to synthetic Ucn1-40. These data suggest that Ucn is produced and processed into the same form of synthetic Ucn in placenta, but not secreted into maternal blood.     

Suppressive effects of Bifidobacterium longum on the production of Th2-attracting chemokines induced with T cell–antigen-presenting cell interactions

In human trials, Bifidobacterium longum BB536 alleviates subjective symptoms of Japanese cedar pollinosis, an IgE-mediated type I allergy caused by exposure to Japanese cedar, and significantly suppresses the increase of plasma thymus- and activation-regulated chemokine (TARC) associated with pollen dispersion. In the present study, we investigated the suppressive effects of BB536 on the production of T helper type 2 (Th2)-attracting chemokines, such as TARC and macrophage-derived chemokine (MDC), together with the mechanisms of their production. Murine splenocytes were cultured with heat-killed BB536, and the levels of Th2-attracting chemokines in the supernatants were measured. TARC and MDC were produced in cultures without stimulation, and the production was significantly suppressed by BB536. These chemokines were produced by antigen-presenting cells (APCs) of splenocytes stimulated with an anti-CD40 antibody. Furthermore, TARC production was induced with granulocyte macrophage colony-stimulating factor that was produced by T cells and dendritic cells. BB536 suppressed MDC production induced with the anti-CD40 antibody by APCs from the spleen, mesenteric lymph nodes (MLNs) and Peyer's patches, and it suppressed TARC production by APCs from the spleen and MLNs. These results indicate that BB536 suppresses the production of Th2-attracting chemokines induced by the T cell–APC interaction, suggesting a novel mechanism for alleviating symptoms of allergic disorders by probiotics.     

A wheat histone H3 promoter confers cell division-dependent and -independent expression of the gus A gene in transgenic rice plants

To investigate developmental regulation of wheat histone H3 gene expression, the H3 promoter, which has its upstream sequence to ?1711 (relative to the cap site as +1), was fused to the coding region of the gus A gene (?1711H3/GUS) and introduced into a monocot plant, rice. Detailed histochemical analysis revealed two distinct types of GUS expression in transgenic rice plants; one is cell division-dependent found in the apical meristem of shoots and roots and in young leaves, and another is cell division-independent detected in flower tissues including the anther wall and the pistil. In this study, replication-dependent expression occurring in non-dividing cells which undergo endoreduplication could not be discriminated from strict replication-independent expression. The observed expression pattern in different parts of roots suggested that the level of the H3/GUS gene expression is well correlated with activity of cell division in roots. To identify 5′ sequences of the H3 promoter necessary for an accurate regulation of the GUS expression, two constructs containing truncated promoters, ?908H3/GUS and ?185H3/GUS, were analyzed in transiently expressed protoplasts, stably transformed calli and transgenic plants. The results indicated that the region from ?909 to ?1711 contains the positive cis-acting element(s) and that the proximal promoter region (up to ?185) containing the conserved hexamer, octamer and nonamer motifs is sufficient to direct both cell division-dependent and -independent expression. The use of the meristem of roots regenerated from transformed calli for the analysis of cell division-dependent expression of plant genes is discussed.     

Four tandem defective P elements associated with positive regulation of theDrosophila melanogaster glucose-6-phosphate dehydrogenase gene

Three high-glucose-6-phosphate dehydrogenase (G6PD)-activity mutants (2512H, S44H, and 1FH) are characterized by two insertion sequences associated with the G6PD locus; one (Ins1; 3.5 kb long in 2512H and S44H and 2.9 kb long in 1FH) is present just 5' to exon I and consists of a KP' (the 32nd base of the KP was replaced by guanine), a core sequence and a KP, and the other is 4.2 kb long and resides within an intron. Southern blot analyses of revertants showing low G6PD activity suggested that the insertion sequence responsible for high G6PD activity may be the core sequence but not the flanking KP and KP' or the Ins2. DNA sequencing data of the clone carrying the core sequence of 2512H demonstrated that the core sequence is another type of defective P elements (core P). Interestingly, a protein(s) was found in the nuclear extract of Canton S embryos that specifically binds to the core P but not to the KP or various fragments of p pi 25.1. In addition, the mutant G6PD activity was found to be affected not only by the genotype, but also by cytoplasmic factors.     

Mating behavior ofXylotrechus pyrrhoderus Bates (Coleoptera: Cerambycidae) V. Female mounting behavior

Female mounting behavior was observed in the grape borerXylotrechus pyrrhoderus Bates (Coleoptera: Cerambycidae) under laboratory conditions. This behavior was directed towards either females (i.e., female homosexual mounting) or males. The female homosexual mounting was strongly elicited in females which had previously been allowed to fly. The frequency of this behavior was not related to the experience of mating. The investigation of the daily temporal pattern in female homosexual mounting activity indicated that the behavior most frequently occurred between 12∶00 and 16∶00, i.e., when females were searching for the pheromone-releasing males. Oviposition was also observed during this time interval. A detailed analysis revealed female mounting behaviors which are characteristic of male mounting behaviors, such as chasing conspecifics and synchronism of licking and abdominal bending. On the other hand, the frequency of male homosexual mounting was lower than that of females. Taken together with cases of other species previously reported, the expression of mounting behavior in females may be related to the evolution of the reproductive system, in which females approach their mates.     

The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.

The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).