(Beta alpha)8-barrel proteins of tryptophan biosynthesis in the hyperthermophile Thermotoga maritima.

To better understand the evolution of a key metabolic pathway, we have sequenced the trpCFBA gene cluster of the hyperthermophilic bacterium Thermotoga maritima. The genes were cloned by complementation in vivo of trp deletion strains of Escherichia coli. The new sequences, together with earlier findings, establish that the trp operon of T.maritima has the order trpE(G.D)CFBA, which might represent the ancestral organization of the tryptophan operon. Heterologous expression of the trp(G.D) and trpC genes in E.coli and N-terminal sequencing of their polypeptide products showed that their translation is initiated at the rate start codons TTG and ATC, respectively. Consequently, the N-terminus of the trp(G.D) fusion protein is 43 residues shorter than previously postulated. Amino acid composition and sequence analyses of the protein products of T.maritima trpC (indoleglycerol phosphate synthase), trpF (phosphoribosyl anthranilate isomerase) and trpA (alpha-subunit of tryptophan synthase) suggest that these thermostable (beta alpha)8-barrel proteins may be stabilized by additional salt bridges, compared with the mesostable forms. Another notable feature is the predicted lack of the N-terminal helix alpha 0 in the alpha-subunit of tryptophan synthase.     

Identification of a novel cellulose-binding domain the multidomain 120 kDa xylanase XynA of the hyperthermophilic bacterium Thermotoga maritima

A segment of Thermotoga maritima strain MSB8 chromosomal DNA was isolated which encodes an endo-1,4-β-D-xylanase, and the nucleotide sequence of the xylanase gene, designated xynA, was determined. With a half-life of about 40 min at 90°C at the optimal pH of 6.2, purified recombinant XynA is one of the most thermostable xylanases known. XynA is a 1059-amino-acid (?120 kDa) modular enzyme composed of an N-terminal signal peptide and five domains, in the order A1-A2-B-C1-C2. By comparison with other xylanases of family 10 of glycosyl hydrolases, the central ?340-amino-acid part (domain B) of XynA represents the catalytic domain. The N terminal ?150-amino-acid repeated domains (A1-A2) have no significant similarity to the C-terminal ?170-amino-acid repeated domains (C1-C2). Cellulose-binding studies with truncated XynA derivatives and hybrid proteins indicated that the C-terminal repeated domains mediate the binding of XynA to microcrystalline cellulose and that C2 alone can also promote cellulose binding. C1 and C2 did not share amino acid sequence similarity with any other known cellulose-binding domain (CBD) and thus are CBDS of a novel type. Structurally related protein segments which are probably also CBDs were found in other multi-domain xylanolytic enzymes. Deletion of the N-terminal repeated domains or of all the non-catalytic domains resulted In substantially reduced tbermostability while a truncated xylanase derivative lacking the C-terminal tandem repeat was as thermostable as the full-length enzyme. It is argued that the multidomain organization of some enzymes may be one of the strategies adopted by thermophiles to protect their proteins against thermal denaturation.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Cellulolytic enzymes for the hydrolysis of leached beet cosette

Summary Cellulolytic fungi were isolated from rotting leaves and tested for extra-cellular cellulase activities (CMCase, avicelase, cellobiase and xylanase). The effect of the proportion of the enzyme activities on the rate of degradation of leached beet cosette was observed using a range of supernatant fluids in appropriate combinations. At low cosette concentrations (1.5–3.0 g/l), avicelase and cellobiase were the rate limiting enzymes; avicelase in the initial stages of reaction and cellobiase after 6–8 hours, when cellobiose inhibition becomes important. A ratio of celiobiase to avicelase of approx 2.0 was established as appropriate. At higher substrate concentrations (10 g/l, 40 g/l) the best cellobiase to avicelase ratio was maintained and up to 40% hydrolysis was obtained in the 10 g/l incubation with 10 Uav/l and 20 Ucellob/l. At 100 g/l cosette concentration, substrate inhibition was observed.     

Ultrastructural differentiation during embryonic Drosophila myogenesis in vitro

Summary Cultures of embryonicDrosophila melanogaster cells were examined by electron microscopy and events in myogenesis were recorded. Thick and thin myofilaments, T-tubules and sarcoplasmic reticulum all appeared at about the same time, 10.5 hr. This was about 5 hr after the final division of myoblasts and about the time that muscle cells were elongating, aligning and fusing. Sarcoplasm typical of insect muscle was detected by 18.5 hr, as were myotendonal and tendocuticular junctions. Two populations of myocytes were detected, the cytoplasm of one more electron-dense than the other. The only previous report of myofibrilogenesis in invertebrate embryos had described novel mechanisms. InDrosophila embryonic material, however, the sequence of myofibrilogenesis resembled that in post-embryonic insect or vertebrate material. Mrs. Pilar Toribio-Fiorio provided excellent technical assistance, and Patricia Minter, the secretarial expertise. This investigation was supported, in part, by NIH Grant NS9330 and the James Douglas Research Fund to Robert L. Seecof and NIH Grant No. 1 RO1 CA17223-01 to Raymond L. Teplitz.     

Native tree regeneration in native tree plantations: understanding the contribution of Araucaria angustifolia to biodiversity conservation in the threatened Atlantic Forest in Argentina

Deforestation is a global process that has strongly affected the Atlantic Forest in South America, which has been recognised as a threatened biodiversity hotspot. An important proportion of deforested areas were converted to forest plantations. Araucaria angustifolia is a native tree to the Atlantic Forest, which has been largely exploited for wood production and is currently cultivated in commercial plantations. An important question is to what extent such native tree plantations can be managed to reduce biodiversity loss in a highly diverse and vulnerable forest region . We evaluated the effect of stand age, stand basal area, as a measure of stand density, and time since last logging on the density and richness of native tree regeneration in planted araucaria stands that were successively logged over 60 years, as well as the differences between successional groups in the response of plant density to stand variables. We also compared native tree species richness in planted araucaria stands to neighbouring native forest. Species richness was 71 in the planted stands (27 ha sampled) and 82 in native forest (18 ha sampled) which approximate the range of variation in species richness found in the native forests of the study area. The total abundance and species richness of native trees increased with stand age and time since last logging, but ecological groups differed in their response to such variables. Early secondary trees increased in abundance with stand age 3–8 times faster than climax or late secondary trees. Thus, the change in species composition is expected to continue for a long term. The difference in species richness between native forest and planted stands might be mainly explained by the difference in plant density. Therefore, species richness in plantations can contribute to local native tree diversity if practices that increase native tree density are implemented.     

The effectiveness of flower strips and hedgerows on pest control,pollination services and crop yield: a quantitative synthesis

Floral plantings are promoted to foster ecological intensification of agriculture through provisioning of ecosystem services. However, a comprehensive assessment of the effectiveness of different floral plantings, their characteristics and consequences for crop yield is lacking. Here we quantified the impacts of flower strips and hedgerows on pest control (18 studies) and pollination services (17 studies) in adjacent crops in North America, Europe and New Zealand. Flower strips, but not hedgerows, enhanced pest control services in adjacent fields by 16% on average. However, effects on crop pollination and yield were more variable. Our synthesis identifies several important drivers of variability in effectiveness of plantings: pollination services declined exponentially with distance from plantings, and perennial and older flower strips with higher flowering plant diversity enhanced pollination more effectively. These findings provide promising pathways to optimise floral plantings to more effectively contribute to ecosystem service delivery and ecological intensification of agriculture in the future.     

Satellite DNA landscapes after allotetraploidization of quinoa (Chenopodium quinoa) reveal unique A and B subgenomes

If two related plant species hybridize, their genomes may be combined and duplicated within a single nucleus, thereby forming an allotetraploid. How the emerging plant balances two co‐evolved genomes is still a matter of ongoing research. Here, we focus on satellite DNA (satDNA), the fastest turn‐over sequence class in eukaryotes, aiming to trace its emergence, amplification, and loss during plant speciation and allopolyploidization. As a model, we used Chenopodium quinoa Willd. (quinoa), an allopolyploid crop with 2n = 4x = 36 chromosomes. Quinoa originated by hybridization of an unknown female American Chenopodium diploid (AA genome) with an unknown male Old World diploid species (BB genome), dating back 3.3–6.3 million years. Applying short read clustering to quinoa (AABB), C. pallidicaule (AA), and C. suecicum (BB) whole genome shotgun sequences, we classified their repetitive fractions, and identified and characterized seven satDNA families, together with the 5S rDNA model repeat. We show unequal satDNA amplification (two families) and exclusive occurrence (four families) in the AA and BB diploids by read mapping as well as Southern, genomic, and fluorescent in situ hybridization. Whereas the satDNA distributions support C. suecicum as possible parental species, we were able to exclude C. pallidicaule as progenitor due to unique repeat profiles. Using quinoa long reads and scaffolds, we detected only limited evidence of intergenomic homogenization of satDNA after allopolyploidization, but were able to exclude dispersal of 5S rRNA genes between subgenomes. Our results exemplify the complex route of tandem repeat evolution through Chenopodium speciation and allopolyploidization, and may provide sequence targets for the identification of quinoa's progenitors.     

Prognostic factors and survival in metastatic breast cancer: A single institution experience

Background

The current retrospective study aims to identify some determinants of survival in metastatic breast cancer.

Methods

The study concerned 332 patients with synchronous (SM) or metachronous (MM) metastatic breast cancer treated between January 2000 and December 2007. Statistical comparison between subgroups of patients concerning survival was carried out employing log-rank test for the invariable analysis and Cox model for the multivariable analysis. Factors included: age group (≤50 years vs. >50; ≤70 years vs. >70; ≤35 years vs. >35), menopausal status, presentation of metastatic disease (SM vs. MM), disease free interval (DFI) (≤24 months vs. >24 months; ≤60 months vs. >60 months), performance status at diagnosis of metastatic disease (PS) (0–1 vs. >1), hormone receptors (HR), number of metastatic sites (1 site vs. >1), nature of the metastatic site (visceral vs. non visceral), first line therapy, surgery of the primary tumor (SPT), locoregional radiotherapy (LRRT) and use or not of bisphosphonates.

Results

Overall survival at 5 years was 12%. Positive prognostic factors in univariate analysis were: age ≤ 70 years, hormono-dependence of the tumor, good PS (PS 0–1), less than two metastatic sites, no visceral metastases, DFI ≥ 24 months, SPT or LRRT. In multivariate analysis, favorable independent prognostic factors included: good PS (PS 0–1), absence of visceral metastases (liver, lung, brain) and age ≤ 70 years.

Conclusion

Many of the prognostic factors in metastatic breast cancer found in our study are known in the literature but some of them, like the application of locoregional treatment (radiotherapy or surgery) and the use of bisphosphonates, need to be further investigated in randomized clinical trials.     

Continuous production of selenomethionine-enriched Chlorella sorokiniana biomass in a photobioreactor

This article describes the enrichment of the fresh-water green microalga Chlorella sorokiniana in selenomethionine (SeMet). The microalga was cultivated in a 2.2 L glass-vessel photobioreactor, in a culture medium supplemented with selenate (SeO₄^2?) concentrations ranging from 5 to 50 mg L^?1. Although selenate exposure lowered culture viability, C. sorokiniana grew well at all tested selenate concentrations, however cultures supplemented with 50 mg L^?1 selenate did not remain stable at steady state. A suitable selenate concentration in fresh culture medium for continuous operation was determined, which allowed stable long-term cultivation at steady state and maximal SeMet productivity. In order to do that, the effect of dilution rate on biomass productivity, viability and SeMet content of C. sorokiniana at several selenate concentrations were determined in the photobioreactor. A maximal SeMet productivity of 21 μg L^?1 day^?1 was obtained with 40 mg L^?1 selenate in the culture medium. Then a continuous cultivation process at several dilution rates was performed at 40 mg L^?1 selenate obtaining a maximum of 246 μg L^?1 day^?1 SeMet at a low dilution rate of 0.49 day^?1, calculated on total daily effluent volume. This paper describes for the first time an efficient long-term continuous cultivation of C. sorokiniana for the production of biomass enriched in the high value amino acid SeMet, at laboratory scale.