Enhanced interferon-alpha/beta (IFN-alpha/beta) and defective IFN-gamma production in chronic graft versus host disease: a potential mechanism for immunosuppression

Immunosuppression is a well-characterized consequence of chronic graft-versus-host disease (GVHD). We have previously shown that interferon (IFN) is produced in high levels during acute GVHD. Our objective in this study was to determine if IFN, as a cytokine with known immunosuppressive qualities, could be detected in mice experiencing chronic GVHD-induced immunosuppression. Two different experimental models were used to induce chronic GVHD. The first model involved the injection of parental strain spleen cells into adult F1 hybrids (AJ----B6AF1), while the second model utilized GVHD induced across minor histocompatibility barriers (B10.D2----BALB/c). Results indicated that significant levels of serum IFN-alpha/beta are present in mice undergoing chronic GVHD. Spleen cells from chronic GVHD mice were also shown to produce significant levels of IFN-alpha/beta upon in vitro culture in medium only. This IFN-alpha/beta production was greatly increased when GVHD spleen cells were cultured with either concanavalin A (Con A) or IL-2. In contrast, IFN-gamma production was undetectable in these Con A- or IL-2-containing cultures. Additionally, these same spleen cells which produced high levels of IFN-alpha/beta were immunosuppressed as measured by mitogen-induced cell proliferation. These results suggest that IFN-gamma production is defective in GVHD spleen cells, and that the presence of high IFN-alpha/beta production by GVHD mice may contribute to the immunosuppression associated with chronic GVHD.     

The P-M Hybrid Dysgenesis Cline in Eastern Australian Drosophila melanogaster: Discrete P, Q and M Regions Are Nearly Contiguous

The dramatic latitudinal cline in P-M hybrid dysgenesis characteristics along the east coast of Australia is not smooth. Tests of recent collections of Drosophila melanogaster from the southeastern coast define the previously described cline as comprising three discrete, apparently contiguous regions of P, Q and M phenotypes, respectively. Northern populations from Cairns (16.9°SLat) to Ourimbah (33.4°SLat) are phenotypically P; populations from Wollongong (34.4°SLat) to Eden (37.1°SLat) are Q; and populations from Genoa (37.5°SLat) to Cygnet (43.2°SLat) are M. The decline in P activity from northern Queensland (55-60% gonadal dysgenesis (GD) in cross A) to mid-New South Wales (20-30% GD in cross A) is gradual; proceeding south, there then is a sharp drop to Q populations (<10% GD in crosses A and A*). This drop in P activity occurs in only 150 km, across the urban and suburban area of Sydney. Q populations are then found south to Eden, but Genoa, only about 50 km further southeast, is clearly M (48% GD in cross A*), as are two populations further south. The two discontinuities in the P-M cline do not correspond to obvious climatic differences along the coast, nor to obvious barriers to dispersal of D. melanogaster. The cline has apparently not moved between 1983 and 1985-1986.     

The adenovirus Ela gene induces differentiation of F9 teratocarcinoma cells.

Undifferentiated F9 cells transfected with plasmids encoding adenovirus E1a gene products underwent radical morphological changes. They ceased to express the SSEA-1 stem cell marker antigen and started to express a number of the characteristics of the differentiated state that is induced in F9 cells by treatment with retinoic acid. In particular, they expressed keratin intermediate filaments and acquired the ability to synthesise simian virus 40 tumor antigens after virus infection. The transfected cells expressed the E1a proteins, and this expression was necessary to induce the phenotypic changes, since a coisogenic plasmid encoding only a truncated 70-amino-acid E1a polypeptide and the transfection procedure itself did not detectably after the morphology or marker expression of the F9 stem cells. The phenotypic change was induced by both 13S and 12S cDNA plasmids. We discuss these results in the context of known E1a functions and with reference to the other oncogenes and external factors that can cause F9 cell differentiation.     

Connective tissue influences on the expression of epithelial cell-surface antigens

Summary Adult mice were found to show regional variation in the epithelial expression of some molecules of the blood-group antigen series. To investigate connective tissue influences on such differences, heterotypic recombinants of epithelia and connective tissues from various regions were prepared and examined using monoclonal antibodies directed against bloodgroup antigens H and Le^y. The results indicate that epithelia may maintain a preexisting regionally specific pattern following recombination but that, in some recombinant matches, the connective tissue is capable of signalling redirection of the pattern of expression towards that typical of the epithelium with which it is normally associated.This work was supported by NIH-NIDR RO1-DEO-5190     

Anti-thrombin activities of heparin. Effect of saccharide chain length on thrombin inhibition by heparin cofactor II and by antithrombin.

The interactions of two proteinase inhibitors, heparin cofactor II and antithrombin, with thrombin are potentiated by heparin. Using two methods, we have studied the potentiating effects of a series of heparin (poly)saccharides with high affinity for antithrombin and mean Mr ranging from approx. 1700 to 18,800. First, catalytic amounts of heparin (poly)saccharide were added to purified systems containing thrombin and either heparin cofactor II or antithrombin. Residual thrombin activity was determined with a chromogenic substrate. It was found that only the higher-Mr polysaccharides (Mr greater than 8000) efficiently catalysed thrombin inhibition by heparin cofactor II, there being a progressive catalytic effect with increasing Mr of the polysaccharide. Weak accelerating effects were noted with low-Mr saccharides (Mr less than 8000). This contrasted with the well-characterized interaction of heparin with antithrombin and thrombin, where heparin oligosaccharides of Mr less than 5400 had absolutely no ability to accelerate the reaction, while (poly)saccharides of Mr exceeding 5400 showed rapidly increasing catalytic activity with increasing Mr. Secondly, these and other heparin preparations were added in a wide concentration range to plasma with which 125I-labelled thrombin was then incubated for 30 s. Inhibited thrombin was determined from the distribution of labelled thrombin amongst inhibitor-thrombin complexes, predominantly antithrombin-thrombin and heparin cofactor II-thrombin complexes. In this situation, where the inhibitors competed for thrombin and for the (poly)saccharides, it was found that, provided the latter were of high affinity for antithrombin and exceeded a Mr of 5400, thrombin inhibition in plasma was mediated largely through antithrombin. Polysaccharides of Mr exceeding 8000 that were of low affinity for antithrombin accelerated thrombin inhibition in plasma through their interaction with heparin cofactor II. High concentrations of saccharides of Mr 1700-5400 exhibited a size-dependent acceleration of thrombin inhibition, not through their interaction with antithrombin, but through their interaction with heparin cofactor II.     

N.m.r. assignments and temperature-dependent conformational transitions of a mutant trp operator-promoter in solution.

A total of 145 protons in the mutant trp operator-promoter sequence CGTACTGATTAATCAGTACG were assigned by one-dimensional and two-dimensional n.m.r. methods. Except at the sites of mutation (underlined), the chemical shifts and other n.m.r. parameters are very similar to those observed in the symmetrized wild-type sequence [Lefèvre, Lane & Jardetzky (1987) Biochemistry 26, 5076-5090]. Spin-spin-relaxation rate constants of the resolved base protons and intra- and inter-nucleotide nuclear-Overhauser-enhancement intensities argue for a sequence-dependent structure similar to that of the wild-type, except at and close to the sites of the mutation. The overall tumbling time as a function of temperature was determined from cross-relaxation rate constants for the H-6-H-5 vectors of the four cytosine residues. The values are consistent with the oligonucleotide maintaining a double-helical conformation over the entire temperature range 5-45 degrees C, and that internal motions of the bases are of small amplitude on the subnanosecond time scale. The temperature-dependence of chemical shifts, spin-spin-relaxation rate constants and cross-relaxation rate constants show the occurrence of two conformational transitions localized to the TTAA sequence in the centre of the molecule. The thermodynamics of the transition at the lower temperature (tm = 16 degrees C) were analysed according to a two-state process. The mid-point temperature is about 6 degrees C higher than in the wild-type sequence. The conformational transition does not lead to rupture of the Watson-Crick hydrogen bonds, but probably involves changes in the propellor twists of T.A-9 and T.A-10. The second transition occurs at about 40 degrees C, but cannot be fully characterized. This conformational variability seems to be a property of the sequence TTAA, and may have functional significance in bacterial promoters.     

Nuclear protein p68 is an RNA-dependent ATPase.

The human nuclear antigen p68 cross reacts with a monoclonal antibody to SV40 large-T antigen. Its deduced amino acid sequence contains short motifs which place it in a large superfamily of proteins of known or putative helicase activity. Recently, a p68 subfamily (DEAD box proteins) which share more extensive regions of homology has been identified in mouse, Drosophila, Saccharomyces cerevisiae and Escherichia coli. These proteins are involved in translation, ribosome assembly, mitochondrial splicing, spermatogenesis and embryogenesis. We show here that immunopurified human p68 has RNA dependent ATPase activity. In addition, we show that the protein undergoes dramatic changes in cellular location during the cell cycle.