Formation of 19-nor-10-keto-25-hydroxyvitamin D3 in cultured mammalian cells

The results of normal mode calculations on the beta 4.4, beta 6.3, beta 5.6, and beta 7.2 structures of gramicidin A are compared with infrared and Raman spectra of crystalline native, crystalline Cs+-bound, and vesicle-bound gramicidin A. The observed frequencies and frequency splittings are in good agreement with an assignment of beta 5.6, beta 7.2, and beta 6.3 structures, respectively, to the gramicidin A molecules in the above three systems.     

Amino acid transport in the rat exocrine pancreas

Summary Amino acid transport and incorporation have been studied in vitro in rat pancreatic lobules after maximal and supramaximal hormonal stimulation with caerulein. Incorporation into proteins was increased already after 30 and 120 min of maximal stimulation, but was decreased after the infusion of a supramaximal dose. Uptake of neutral amino acids was monitored using labeled leucine and -aminoisobutyric acid (AIB). In the case of leucine the free pool was consistently reduced after maximal stimulation, while supramaximal doses led to an increase which could be potentiated by the addition of 2mM tetracaine. Using AIB, a significant increase in the intracellular pool was observed after maximal stimulation, conversely a decrease after supramaximal stimulation. Release of labeled leucine and AIB from preloaded lobules during incubation in the cold was significantly reduced after maximal secretory stimulation, but was found enhanced by 200 to 300 percent after supramaximal stimulation. No fine structural alterations at junctional complexes or at both the lateral and luminal plasma membranes were observed after maximal stimulation except an increased number of exocytotic figures at the luminal face. However, supramaximal stimulation led to progressive rarefaction of the tight junctional network and disintegration of the gap junctions. Concomitantly, an equal distribution of membrane particles on both faces of the plasma membrane together with a random occurrence of exocytotic figures were observed.Supported by a grant from the Deutsche Forschungsgemeinschaft, Bonn-Bad Godesberg (SFB 122, project C 5). Dedicated to Professor Dr. Gerhard Petry, Marburg, on the occasion of his 65th birthday     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Biosynthesis of glycosylated human lysozyme mutants.

Complementary DNA encoding human lysozyme was subjected to oligonucleotide-directed mutagenesis. At one of three selected positions, amino acid residues 22, 68, or 118, the signal for N-linked glycosylation was created. The mutant DNAs were inserted into a eucaryotic vector and transfected into cultured hamster cells. The three mutant cDNAs directed synthesis of lysozyme mutants, which were named LI, LII, and LIII. The mutant lysozymes LI and LII comprised mixtures of glycosylated and nonglycosylated forms. The glycosylated and nonglycosylated forms of mutant LI were found to have an enzymatic activity similar to normal human milk lysozyme. The usage of the glycosylation sites in the mutants was similar in Chinese hamster ovary (CHO) and baby hamster kidney cells. Approximately two of every three molecules in mutant LI, approximately one of every eight molecules in mutant LII, and practically no molecules in mutant LIII became glycosylated. In CHO cells, the processing of the oligosaccharide side chains yielded several larger products than in baby hamster kidney cells. This size variability of glycosylated lysozyme from CHO cells may be explained by the presence of biantennary and triantennary endo-beta-N-acetylglucosaminidase H-resistant oligosaccharides with N-acetyllactosamine repeats of variable length and by the presence of hybrid oligosaccharides, as suggested by affinity to several lectins and sensitivity to endo-beta-galactosidase. In both cell types, the majority of the glycosylated forms were secreted and thus behaved similarly to nonglycosylated lysozyme. A small proportion of mutant LI lysozyme remained associated with the cells. The retained lysozyme was recruited predominantly from the molecules bearing high mannose oligosaccharides. These molecules were targeted to lysosomes, and their carbohydrate was trimmed to an endo-beta-N-acetylglucosaminidase H-resistant form. Owing to the small size of mutant LI lysozyme, minor changes in the size of its carbohydrate moiety result in detectable changes in the electrophoretic mobility of the whole glycoprotein. We suggest that this novel glycoprotein could be used as a reporter in studies on processing and segregation of glycoproteins.     

A segment of rye chromosome 1 enhances growth and embryogenesis of calli derived from immature embryos of wheat

Summary The influence of the short arm of rye chromosome 1 (1RS) from Secale cereale var. Imperial on the growth and differentiation of callus cultures from wheat Triticum aestivum var. Chinese Spring immature embryos was analysed. This chromosome arm was found to stimulate both embryogenesis and the rate of growth of calli. Recombinant lines carrying segments of 1RS were used to delineate the regions of 1RS responsible for the tissue culture effects. The enhancement of embryogenesis and the stimulation of growth were shown to be associated with two distinct genetic regions of the chromosome arm; the former is located between the centromere and the Sec 1 locus, while the latter is situated in the immediate vicinity of the Sec 1 locus.     

Homoiogenetic Neural Inducing Activity of the Presumptive Neural Plate of Xenopus Laevis

Heteroplastic combinations were made between Xenopus laevis presumptive neural plate and competent ectoderm of Xenopus borealis . Primarily induced presumptive neural plate cells ( Xenopus laevis ) can easily be distinguished from Xenopus borealis cells by specific quinacrine fluorescence of the nuclei. It was clearly shown that presumptive neural plate, which has primarily been induced by the underlying chordamesoderm exerts homoiogenetic inducing activity on competent ectoderm. The inducing activity is increased in pieces of presumptive neural plates, when the superficial layer has been removed from the adjacent deep layers. The enhancement can be explained by the fact that the removal of the superficial layer acting as barrier allows the inducing stimulus to be easily propagated from the apical (distal) side of the deep layers of the presumptive neural plate.     

The eco-sociological value of dispersal spectra of two plant communities

Summary A new system of dispersal units has been elaborated, based on weight and morphological features functional in dispersal. Weight was divided into eight classes and the functional morphological features were selected in such a way that their effectiveness could be tested by experiments.The spectra of weight and dispersal adaptations of dispersal units sampled in Euphorbio-Pinetum nigrae and Fumano-Stipetum habitats south of Vienna are calculated with this system and then compared.The results show that both communities can be characterized with such spectra. It is also possible with these spectra to make statements about the ecological and social position of the association in a succession.Nomenclature follows Ehrendorfer (1973).