A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Binding properties of 23S,25-dihydroxyvitamin D3: an in vivo metabolite of vitamin D3

23$\text{S}$,25-Dihydroxyvitamin D₃ was isolated from the plasma of vitamin D₃-toxic pigs. An ultraviolet absorbance spectrum confirmed its purity. The configuration of the 23-hydroxyl group was determined to be S by comparison of the natural product with synthetic 23$\text{R}$,25- and 23$\text{S}$,25-dihydroxyvitamin D₃ by high-pressure liquid chromatography. The affinity of both 23$\text{S}$,25- and 23$\text{R}$,25-dihydroxyvitamin D₃ for the plasma vitamin D binding protein was similar to vitamin D₃. Thus, with respect to the plasma vitamin D binding protein, 23$\text{S}$,25-dihydroxyvitamin D₃ is the least potent, naturally-occurring, dihydroxylated vitamin D₃ metabolite known.     

The inhibitory effect of ethanol on ethanol production by Zymomonas mobilis

Summary In an effort to establish the reasons for the limitations in the final ethanol concentration of Zymomonas mobilis fermentation, the effects of CO₂ and ethanol on the fermentation were investigated using continuous and fed-batch cultivation systems. The nucleation and stripping out of CO₂ from the fermenter using diatomaceous earth or nitrogen gas or both exhibited a profound effect on the glucose uptake rate during the early stages of fed-batch fermentation, but did not improve final ethanol yields. The addition of ethanol together with above mentioned experiments confirmed conclusively that ethanol inhibition is responsible for the final ethanol concentration obtainable during Zymomonas mobilis fermentation. The final concentration lies between 90 and 110 gl⁻¹ or approximately 12–15% (v/v) ethanol.     

1,25-Dihydroxyvitamin D3 receptor in bovine thymus gland

1,25-Dihydroxyvitamin D₃ [1,25-(OH)₂D₃] receptor was characterized after partial purification of thymus cytosol by ammonium sulfate fractionation. The 1,25-(OH)₂D₃ receptor sediments at 3.7S in 5–20% sucrose gradients. The binding of 1,25-(OH)₂D₃ in thymic cytosol was a saturable process with high affinity (Kd = 0.12?0.48 nM) at 4°C. Competition for 1,25-(OH)₂[³H]D₃ receptor by nonradioactive analogs demonstrated the affinities of these analogs to be in order; 1,25-(OH)₂D₃ = 1,24R,25-(OH)₃D₃ = 1,25S,26-(OH)₃D₃ = 1,25R,26-(OH)₃D₃ > 1,25-(OH)₂D₃-26,23 lactone > 25-OHD₃ > 23R,25-(OH)₂D₃ > 24R,25-(OH)₂D₃ > 23S,25-(OH)₂D₃ ? 25-OHD₃-26,23 lactone. The receptor bound to DNA cellulose columns in low salt buffer and eluted as a single peak at 0.21 M KCl. These findings provide evidence that the thymus possesses a 1,25-(OH)₂D₃ receptor with properties indistinguishable from 1,25-(OH)₂D₃ receptors in other tissues.     

Biosynthesis of glycosylated human lysozyme mutants.

Complementary DNA encoding human lysozyme was subjected to oligonucleotide-directed mutagenesis. At one of three selected positions, amino acid residues 22, 68, or 118, the signal for N-linked glycosylation was created. The mutant DNAs were inserted into a eucaryotic vector and transfected into cultured hamster cells. The three mutant cDNAs directed synthesis of lysozyme mutants, which were named LI, LII, and LIII. The mutant lysozymes LI and LII comprised mixtures of glycosylated and nonglycosylated forms. The glycosylated and nonglycosylated forms of mutant LI were found to have an enzymatic activity similar to normal human milk lysozyme. The usage of the glycosylation sites in the mutants was similar in Chinese hamster ovary (CHO) and baby hamster kidney cells. Approximately two of every three molecules in mutant LI, approximately one of every eight molecules in mutant LII, and practically no molecules in mutant LIII became glycosylated. In CHO cells, the processing of the oligosaccharide side chains yielded several larger products than in baby hamster kidney cells. This size variability of glycosylated lysozyme from CHO cells may be explained by the presence of biantennary and triantennary endo-beta-N-acetylglucosaminidase H-resistant oligosaccharides with N-acetyllactosamine repeats of variable length and by the presence of hybrid oligosaccharides, as suggested by affinity to several lectins and sensitivity to endo-beta-galactosidase. In both cell types, the majority of the glycosylated forms were secreted and thus behaved similarly to nonglycosylated lysozyme. A small proportion of mutant LI lysozyme remained associated with the cells. The retained lysozyme was recruited predominantly from the molecules bearing high mannose oligosaccharides. These molecules were targeted to lysosomes, and their carbohydrate was trimmed to an endo-beta-N-acetylglucosaminidase H-resistant form. Owing to the small size of mutant LI lysozyme, minor changes in the size of its carbohydrate moiety result in detectable changes in the electrophoretic mobility of the whole glycoprotein. We suggest that this novel glycoprotein could be used as a reporter in studies on processing and segregation of glycoproteins.     

Root-microbial effects on plant iron uptake from siderophores and phytosiderophores

Collaborative experiments were conducted to determine whether microbial populations associated with plant roots may artifactually affect the rates of Fe uptake and translocation from microbial siderophores and phytosiderophores. Results showed nonaxenic maize to have 2 to 34-fold higher Fe-uptake rates than axenically grown plants when supplied with 1 μM Fe as either the microbial siderophore, ferrioxamine B (FOB), or the barley phytosiderophore, epi-hydroxymugineic acid (HMA). In experiments with nonsterile plants, inoculation of maize or oat seedlings with soil microorganisms and amendment of the hydroponic nutrient solutions with sucrose resulted in an 8-fold increase in FOB-mediated Fe-uptake rates by Fe-stressed maize and a 150-fold increase in FOB iron uptake rates by Fe-stressed oat, but had no effect on iron uptake by Fe-sufficient plants. Conversely, Fe-stressed maize and oat plants supplied with HMA showed decreased uptake and translocation in response to microbial inoculation and sucrose amendment. The ability of root-associated microorganisms to affect Fe-uptake rates from siderophores and phytosiderophores, even in short-term uptake experiments, indicates that microorganisms can be an unpredictable confounding factor in experiments examining mechanisms for utilization of microbial siderophores or phytosiderophores under nonsterile conditions.     

A segment of rye chromosome 1 enhances growth and embryogenesis of calli derived from immature embryos of wheat

Summary The influence of the short arm of rye chromosome 1 (1RS) from Secale cereale var. Imperial on the growth and differentiation of callus cultures from wheat Triticum aestivum var. Chinese Spring immature embryos was analysed. This chromosome arm was found to stimulate both embryogenesis and the rate of growth of calli. Recombinant lines carrying segments of 1RS were used to delineate the regions of 1RS responsible for the tissue culture effects. The enhancement of embryogenesis and the stimulation of growth were shown to be associated with two distinct genetic regions of the chromosome arm; the former is located between the centromere and the Sec 1 locus, while the latter is situated in the immediate vicinity of the Sec 1 locus.     

Aberrant splicing of phenylalanine hydroxylase mRNA: the major cause for phenylketonuria in parts of southern Europe.

We report a mutation within the phenylalanine hydroxylase (PAH) gene that causes aberrant splicing of the mRNA and that is in tight association with chromosomal haplotypes 6, 10, and 36. Because of the high frequency of these particular haplotypes in Bulgaria, Italy, and Turkey, it appears to be one of the more frequent defects in the PAH gene causing classical phenylketonuria in this part of Europe. The mutation is a G to A transition at position 546 in intron 10 of the PAH gene, 11 bp upstream from the intron 10/exon 11 boundary. It activates a cryptic splice site and results in an in-frame insertion of 9 nucleotides between exon 10 and exon 11 of the processed mRNA. Normal amounts of liver PAH protein are present in homozygous patients, but no catalytic activity can be detected. This loss of enzyme activity is probably caused by conformational changes resulting from the insertion of three additional amino acids (Gly-Leu-Gln) between the normal sequences encoded by exon 10 and exon 11.     

Phenylalanine hydroxylase gene: novel missense mutation in exon 7 causing severe phenylketonuria.

By direct sequence analysis of 94 mutant phenylalanine hydroxylase alleles using polymerase chain reaction-based techniques, we identified a C to T transition in exon 7 of the human phenylalanine hydroxylase gene that is associated with RFLP haplotypes 1 and 4. A leucine for proline substitution at position 281 can be predicted from the nucleotide sequence of the mutant codon. Expression analysis in cultured mammalian cells after site-directed mutagenesis proved that the base substitution is a disease causing gene lesion. Dot-blot hybridization analysis using allele-specific oligonucleotides revealed that 25% of all mutant haplotype 1 alleles in the German population bear this mutation. In addition, this mutation could be detected on one mutant haplotype 4 allele. The fact that this mutation is associated with only 25% of all mutant haplotype 1 alleles suggests that multiple mutations may be associated with this haplotype. The occurrence of several different mutations would be in agreement with the clinical heterogeneity observed in the group of patients whose PKU alleles belong to haplotype 1.