Protein-lipid interactions and differential scanning calorimetric studies of bacteriorhodopsin reconstituted lipid-water systems

Bacteriorhodopsin has been reconstituted at various molar concentrations into liposomes of dimyristoyl- and also of dipalmitoylphosphatidylcholine. Differential scanning calorimetry indicates that as the protein concentration within the lipid bilayer increases, the cooperativity of the lipid phase transition is reduced, i.e. the transition is broadened, while the midpoint transition temperature remains virtually unchanged. Freeze-fracture electron microscopy of our preparation shows, in agreement with previous data from other laboratories, that extensive protein aggregation occurs when the liposome is cooled below the T_c transition temperature of the lipid. Laser flash photolysis measurements of protein rotation of the bacteriorhodopsin show, especially in the case of protein-rich recombinants, that protein aggregates exist even above T_c. The perturbation caused by the presence of bacteriorhodopsin in the lipid bilayer is similar to that produced by other intrinsic proteins. The difficulty of correlating the observed calorimetric enthalpy data with a simple concept of a ‘boundary lipid layer’ based upon consideration of a single isolated protein is discussed in view of the occurrence of protein aggregates both above and below T_c. It is concluded that the reduction of enthalpy is related to the number of lipids which solvate the protein aggregates within the protein-lipid patches and are thereby removed from the cooperative melting and enthalpy of the remaining regions of pure lipid.     

Cyclin B in fish oocytes: its cDNA and amino acid sequences, appearance during maturation, and induction of p34cdc2 activation.

Under the influence of maturation-inducing hormone (MIH) secreted from follicle cells, oocyte maturation is finally triggered by maturation-promoting factor (MPF), which consists of a homolog of the cdc2+ gene product of fission yeast (p34cdc2) and cyclin B. Two species of cyclin B clones were isolated from a cDNA library constructed from mature goldfish oocytes. Sequence comparisons revealed that these two clones are highly homologous (95%) and were found to be similar to Xenopus cyclin B1. Using monoclonal antibodies against Escherichia coli-produced goldfish cyclin B and the PSTAIR sequence of p34cdc2, we examined the levels of cyclin B and p34cdc2 proteins during goldfish oocyte maturation induced in vitro by 17 alpha, 20 beta-dihydroxy-4-pregnen-3-one (17 alpha, 20 beta-DP), a natural MIH in fish. Protein p34cdc2 was found in immature oocyte extracts and did not remarkably change during oocyte maturation. Cyclin B was not detected in immature oocyte extracts and appeared when oocytes underwent germinal vesicle breakdown. Cyclin B that appeared during oocyte maturation was labelled with [35S]methionine, indicating its de novo synthesis. Introduction of E. coli-produced cyclin B into immature oocyte extracts induced p34cdc2 (MPF) activation. Although the possibility that immature goldfish oocytes contain an insoluble cyclin B is not completely excluded, these results strongly suggest that 17 alpha, 20 beta-DP induces oocytes to synthesize cyclin B, which in turn activates preexisting p34cdc2, forming active MPF.     

The primary structure of the Fab fragment of protein KAU, a monoclonal immunoglobulin M cold agglutinin

The complete amino acid sequence of the Fab fragment of protein KAU, a human monoclonal cold agglutinin (IgMk) with anti-I activity, was determined. The light chain (L-chain) consists of 215 residues; the variable (V)L region belongs to the Hum/Kv325/kIIIb sub-subgroup that is preferentially selected in human IgM autoimmune response. The joining (J) region is encoded by the Jk4 gene, and the constant region (C)L domain expresses the km3 allotypic marker. The Fd fragment contains 232 amino acids, and 120 of them comprise the variable domain. The VH region corresponds to the VHIV subgroup and is closely related to the VHIV 2.1 gene isolated from genomic DNA expressed in peripheral blood of a healthy Caucasian. The complementary-determining region 1 has a unique amino acid (Asp) at position 31, and the complementary-determining region 3 codified by the diversity segment (D) gene, shows poor homology with other known D sequences. The joining segment with two unusual substitutions at the D-J junction is encoded by the JH4 gene. Thus, cold agglutinin KAU is an IgM, VkIIIb-Jk4-km3; VHIV-JH4-C mu.     

A three-dimensional computerized reconstruction of the rectum, anus and surrounding muscles of the rat fetus at the 20th gestation day

Using fetuses of Wistar/I rats on the 20th gestation day. We designed a three-dimensional computerized reconstruction of the rectum, anus and the surrounding muscles. The tissues were fixed in Bouin's solution sagittally sectioned serially were stained with hematoxylin-eosin. Light microscopic pictures at 40 x magnification were subjected to the analysis using a three-dimensional image processing system, consisting of a drum-scanner, a general purpose computer (Micro VAX II), and a color image processor. The results showed that this system clearly reconstructed the three-dimensional image of the rectum, anus and the surrounding muscles and suggested the presence of the puborectal muscle sling.     

Interleukin-4 enhances anti-IgM stimulation of B cells by improving cell viability and by increasing the sensitivity of B cells to the anti-IgM signal

The lymphokine IL-4 is a potent enhancer of anti-IgM-induced B cell proliferation. Although the mechanism of this enhancement is not known, a commonly held view suggests that IL-4 acts together with anti-IgM as a costimulating factor for the activation of a subpopulation of B cells. To evaluate this hypothesis we examined the effect of IL-4 on the proportion of B cells stimulated to divide by different doses of anti-IgM using flow cytometry in combination with measurements of tritiated-thymidine incorporation. The results suggest a novel and surprisingly simple model for the mode of action of IL-4. Our analysis revealed that at high saturating anti-IgM concentrations, the proportion of live B cells which enter into S phase of the cell cycle is the same (approximately 65%) for cells cultured with or without IL-4. Cultures containing IL-4, however, exhibit a twofold increase in thymidine uptake over cultures without IL-4. This increase can be explained completely by the ability of IL-4 to enhance the viability of small dense B cells over the first 24 hr from approximately 50 to 90% of the starting cell number. Normalizing the maximum response levels obtained with and without IL-4 reveals that B cells incubated with IL-4 exhibit a 10-fold decrease in the concentration of anti-IgM required to stimulate the half-maximum proliferation level. Furthermore, evaluation of the number of cells in S phase by flow cytometry and analysis of the kinetics of cell proliferation revealed that the increased response effected by IL-4 at lower anti-IgM concentrations was due to a greater number of proliferating B cells rather than the same number of cells undergoing a faster division rate. We also found a highly nonlinear relationship between B cell number and proliferative response, implying a requirement for an additional, cell cooperation-mediated, activating signal for maximum B cell proliferation. IL-4 enhanced proliferation by the same proportion at all cell concentrations indicating that it does not replace or alter this requirement for cell cooperation. Taken together these results suggest that anti-IgM in combination with a second unidentified cell-cooperation-dependent signal leads to proliferation of up to 65% of small resting B cells. IL-4 does not provide an essential activation signal but serves to raise the sensitivity of B cells to the anti-IgM-generated signal.(ABSTRACT TRUNCATED AT 400 WORDS)     

A novel cDNA clone for acid invertase in tomato fruit.

The sequence of a novel cDNA clone, Aiv-1, for tomato acid invertase was similar to that of TIV1 (Klann et al., 1992) for the enzyme except for a unique intron-like insertion. It is considered that Aiv-1 is derived from either an alternatively spliced mRNA for an isozyme or a pre-mRNA of TIV1.     

Frequency of a 9-bp deletion in the mitochondrial DNA among Asian populations.

Individuals of the following Asian populations were surveyed for the presence of a 9-base-pair deletion of mitochondrial DNA (mtDNA): Ainu, Japanese, Korean, Negrito, and Vedda. Although the variation was detected in every population except the Vedda, the frequencies of the variation differed widely among the populations, suggesting a geographic cline.     

Sequence,proposed secondary structure,and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm

Summary The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3 end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTT GGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.Offprint requests to: S. Loiseaux-de Goër     

Reciprocal translocation between the long arms of chromosomes four and six of Paragonimus westermani from the Philippines.

C-banding patterns have been observed in 14 specimens of Paragonimus westermani from Jaro, Leyte, the Philippines. One of them showed mutations of 2 chromosomes in spreads. Comparative analysis of C-banding patterns between the individual and standard type clarified that the mutant resulted from a reciprocal translocation between the long arms of chromosomes 4 and 6.     

Helix-forming tendencies of amino acids depend on the restrictions of side-chain rotamer conformations: crystal structure of the tripeptide GAI in two crystalline forms.

In our attempts to design crystalline alpha-helical peptides, we synthesized and crystallized GAI (C11H21N3O4) in two crystal forms, GAI1 and GAI2. Form 1 (GAI1) Gly-L-Ala-L-Ile (C11H21N3O4.3H2O) crystals are monoclinic, space group P2(1) with a = 8.171(2), b = 6.072(4), c = 16.443(4) A, beta = 101.24(2) degrees, V = 800 A3, Dc = 1.300 g cm-3 and Z = 2, R = 0.081 for 482 reflections. Form 2 (GAI2) Gly-L-Ala-L-Ile (C11H21N3O4.1/2H2O) is triclinic, space group P1 with a = 5.830(1), b = 8.832(2), c = 15.008(2) A, alpha = 102.88(1), beta = 101.16(2), gamma = 70.72(2) degrees, V = 705 A3, Z = 2, Dc = 1.264 g cm-3, R = 0.04 for 2582 reflections. GAI1 is isomorphous with GAV and forms a helix, whereas GAI2 does not. In GAI1, the tripeptide molecule is held in a near helical conformation by a water molecule that bridges the NH3+ and COO- groups, and acts as the fourth residue needed to complete the turn by forming two hydrogen bonds. Two other water molecules form intermolecular hydrogen bonds in stabilizing the helical structure so that the end result is a column of molecules that looks like an incipient alpha-helix. GAI2 imitates a cyclic peptide and traps a water molecule. The conformation angles chi 11 and chi 12 for the side chain are (-63.7 degrees, 171.1 degrees) for the helical GAI1, and (-65.1 degrees, 58.6 degrees) and (-65.0 degrees, 58.9 degrees) for the two independent nonhelical molecules in GAI2; in GAI1, both the C gamma atoms point away from the helix, whereas in GAI2 the C gamma atom with the g+ conformation points inward to the helix and causes sterical interaction with atoms in the adjacent peptide plane. From these results, it is clear that the helix-forming tendencies of amino acids correlate with the restrictions of side-chain rotamer conformations. Both the peptide units in GAI1 are trans and show significant deviation from planarity [omega 1 = -168(1) degrees; omega 2 = -171(1) degrees] whereas both the peptide units in both the molecules A and B in GAI2 do not show significant deviation from planarity [omega 1 = 179.3(3) degrees; omega 2 = -179.3(3) degrees for molecule A and omega 1 = 179.5(3) degrees; omega 2 = -179.4(3) degrees for molecule B], indicating that the peptide planes in these incipient alpha-helical peptides are considerably bent.