Theophylline reduces poly (ADP-ribose) synthetase from chick embryo liver nuclei

The effect of theophylline on poly(ADP-ribosyl)ation was investigated. The poly(ADP-ribose) synthetase activity in vitro was markedly reduced in the liver nuclei prepared from theophylline-treated chick embryo. This reduction was not due to the enzyme inhibition by theophylline contamination in the nuclear fraction. The hydroxyapatite column chromatographic analysis of [3H]adenosine-labelled poly(ADP-ribose)molecules formed in vivo revealed that the in vivo formation of poly(ADP-ribose)molecules was also decreased by theophylline administration. The theophylline-induced reduction of poly(ADP-ribose) synthesis was not due to either low NAD levels or to a decrease in the chain length of the poly(ADP-ribose) molecule, rather this reduction was derived from a decrease in the number of poly(ADP-ribose) molecule. Possible mechanisms related to reduction of poly(ADP-ribose) synthesis in vivo are discussed.     

Synthesis of polymeric models of elastin: Polyhexapeptides and an insoluble,hybrid cross-linked polypeptide

The polymer of the hexapeptide sequence, Val-Ala-Pro-Gly-Glu-Gly, was synthesized and demostrated of exhibit a reversible, pH-dependent coacervation in low-pH aqueous solution. In addition, the synthesis of an insoluble, hybrid, cross-linked polypeptide matrix is described. The cross-linking was achieved in the coacervate state during flow orientation of the polymers. The chemical means of covalent cross-linking was intermolecular primary amide bond formation between the lysyl side chains in one polypentapeptide unit and the glutamyl side chains in another polyhexapeptide unit. The carboxyl activating reagent was a water-soluble carbodiimide. The key intermediates in the syntheses, the hexamers and their high polymers, were analyzed by carbon-13 magnetic resonance to verify the correctness of synthesis and to obtain information on conformation.     

Freeze-etching studies on ultrastructural changes of endothelial cells in the thyroid of normal,TSH-treated and Thyradin-treated mice

Summary Freeze-etching images of the capillary endothelium in the thyroid of normal, TSH-treated and Thyradin (powdered thyroid)-treated mice were examined. Numerous pores represent vesicular stomata or fenestrations. The number of the pores and their population density are increased in TSH-treated mice, and decreased in Thyradin-treated animals. In addition, the width of the parajunctional zone and of the flat ray free from endothelial pores is smaller in TSH-treated mice and larger in Thyradin-treated animals. These facts indicate that the number of endothelial pores changes according to the functional activity of the gland.Supported by a grant from the Japanese Educational Ministry     

The size of the corpus luteum during pseudopregnancy and pregnancy in the rat.

The corpus luteum in mature Sprague Dawley rats was weighted at the various stages of pseudopregnancy and pregancy. The average size of these corpora lutea was 1.0 +/- 0.10 mg, 1.61 +/- 0.69 mg, 1.90 +/- 0.25 mg, 3.69 +/- 0.36 mg, and 4.37 +/- 0.50 mg on day 2 of diestrus, on days 10-15 of psuedopregnancy, on days 9-10, 14, and 20 of pregnancy, respectively. The fact that the average size of the corpus luteum on days 10-15 of pseudopregnancy was larger than that on day 2 of diestrus is thought to drive from prolonged exposure of the corpus luteum to prolactin. The average size of the corpus luteum on days 9-10 of pregnancy had a tendency to be larger than that on days 10-15 of pseudopregnancy and this seems to demonstrate that the placenta secreted placental lactogen by this stage of pregnancy. The average size of the corpus luteum on day 14 of pregnancy was larger than that on days 9-10 of pregnancy. This phenomenon might be attributed to the presence of large amounts of placental lactogen secreted from the placenta between days 10 and 14 of pregnancy. Furthermore, it was noted that the size of the corpus luteum on day 20 of pregnancy was larger than that of day 14, which suggests that further secretion of placental lactogen continued after day 14 of pregnancy. As there was a remarkable decrease in the number of fetuses on day 20 of pregnancy when overiectomy was performed on day 14 of pregnancy, the ovary was considered indispensable in maintaining pregnancy in the rat.     

Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').