Occurrence of Cryptosporidium Oocysts and Giardia Cysts in Sewage in Norway

Samples of sewage influent from 40 sewage treatment works (STW) throughout Norway were examined for Cryptosporidium oocysts and Giardia duodenalis cysts. Both parasites were detected frequently (80% of STW were Cryptosporidium positive; 93% of STW were Giardia positive) and at maximum concentrations of >20,000 parasites/liter. The data suggest giardiasis is more widespread, and/or occurs with greater infection intensity, than cryptosporidiosis in Norway. STW serving higher person equivalents were more likely to be positive and had higher parasite concentrations. Parasite concentrations were used to estimate the proportion of contributing populations that could be clinically infected. For Cryptosporidium, the highest estimates were up to 5 per 100,000 individuals for two populations in eastern Norway. For Giardia, the highest estimate was 40 infected per 100,000 persons (approximately five times the usual national annual average) contributing to an STW in western Norway. As this population experienced a large waterborne giardiasis outbreak 6 months after sampling, it can be speculated that regular challenge with Giardia may occur here. Most Giardia isolates in sewage influent were assemblage A, although some assemblage B isolates were detected. There was substantial heterogeneity, but most samples contained isolates similar to genotype A3. Removal efficiencies at two STW with secondary treatment processes were estimated to be approximately 50% for Cryptosporidium and >80% for Giardia. An STW with minimal treatment had negligible removal of both parasites. Many STW in Norway have minimal treatment and discharge effluent into rivers and lakes, thus, risk of contamination of water courses by Cryptosporidium and Giardia is considerable.     

Application of genotyping during an extensive outbreak of waterborne giardiasis in Bergen, Norway, during autumn and winter 2004

During the autumn and winter of 2004 and 2005, an extensive outbreak of waterborne giardiasis occurred in Bergen, Norway. Over 1,500 patients were diagnosed with giardiasis. Analysis of water from the implicated source revealed low numbers of Giardia cysts, but the initial contamination event probably occurred up to 10 weeks previously. While sewage leakage from a residential area is now considered to be the probable source of contamination, during the episode waste from one particular septic tank was thought to be a possible source. Genotyping of cysts from the septic tank demonstrated that they were assemblage A cysts, although the sequences were not identical to any previously published sequences. For the beta-giardin gene, the closest published subgenotype was subgenotype A3; for the gdh gene, the closest published subgenotype was subgenotype A2. Genotyping of cysts from 21 patient samples revealed that they were assemblage B cysts; thus, the septic tank was unlikely to be the contamination source. Sequencing of the beta-giardin and gdh genes from patient samples and a comparison of the sequences gave complex results. For the beta-giardin gene, three isolates had sequences identical to subgenotype B3 sequences. However, other isolates had between one and four single-nucleotide polymorphisms (SNPs). For the gdh gene, none of the sequences were identical to the sequence published for subgenotype B3, and the sequences had between one and three SNPs. One isolate, which was identical to subgenotype B3 at the beta-giardin gene, was more similar to subgenotype B2 at the gdh gene. Grouping the isolates on the basis of SNPs resulted in different groups for the two genes. The results are discussed in relation to giardiasis in Norway and to other Giardia genotyping studies.     

Local adaptation within a hybrid species

Ecological divergence among populations may be strongly influenced by their genetic background. For instance, genetic admixture through introgressive hybridization or hybrid speciation is likely to affect the genetic variation and evolvability of phenotypic traits. We studied geographic variation in two beak dimensions and three other phenotypic traits of the Italian sparrow (Passer italiae), a young hybrid species formed through interbreeding between house sparrows (P. domesticus) and Spanish sparrows (P. hispaniolensis). We found that beak morphology was strongly influenced by precipitation regimes and that it appeared to be the target of divergent selection within Italian sparrows. Interestingly, however, the degree of parental genetic contribution in the hybrid species had no effect on phenotypic beak variation. Moreover, beak height divergence may mediate genetic differentiation between populations, consistent with isolation-by-adaptation within this hybrid species. The study illustrates how hybrid species may be relatively unconstrained by their admixed genetic background, allowing them to adapt rapidly to environmental variation.     

Identification of Simian virus 40 promoter DNA sequences capable of conferring restriction endonuclease hypersensitivity.

The simian virus 40 (SV40) DNA sequences found in the enhancer domain, nucleotides (nt) 103 to 177, and the early domain, nt 5149 to 5232, of the SV40 promoter have been analyzed for their ability to confer restriction endonuclease hypersensitivity in SV40 chromatin by using an SV40-based recombinant reporter system. The reporter system consists of a polylinker of various unique restriction endonuclease recognition sequences introduced into SV40 at nt 2666. We observed that the introduction of the enhancer domain at one end of the reporter and the early domain at the other end of the reporter resulted in a 20% increase in nuclease sensitivity within the reporter. In the enhancer domain, an element capable of conferring hypersensitivity was found between nt 114 and 124 with the sequence 5'CTGACTAATTG3', which has previously been shown to be the SV40 AP-1 binding site. In the early domain, an element capable of conferring hypersensitivity was localized to nt 5164 to 5187 and had the sequence 5'CATTTGCAAAGCTTTTTGCAAAAGC3'.     

Stevioside improves pancreatic beta-cell function during glucotoxicity via regulation of acetyl-CoA carboxylase

Chronic hyperglycemia is detrimental to pancreatic beta-cells, causing impaired insulin secretion and beta-cell turnover. The characteristic secretory defects are increased basal insulin secretion (BIS) and a selective loss of glucose-stimulated insulin secretion (GSIS). Several recent studies support the view that the acetyl-CoA carboxylase (ACC) plays a pivotal role for GSIS. We have shown that stevioside (SVS) enhances insulin secretion and ACC gene expression. Whether glucotoxicity influences ACC and whether this action can be counteracted by SVS are not known. To investigate this, we exposed isolated mouse islets as well as clonal INS-1E beta-cells for 48 h to 27 or 16.7 mM glucose, respectively. We found that 48-h exposure to high glucose impairs GSIS from mouse islets and INS-1E cells, an effect that is partly counteracted by SVS. The ACC dephosphorylation inhibitor okadaic acid (OKA, 10(-8) M), and 5-aminoimidazole-4-carboxamide-1-beta-d-ribofuranoside (AICAR, 10(-4) M), an activator of 5'-AMP protein kinase that phosphorylates ACC, eliminated the beneficial effect of SVS. 5-Tetrade-cyloxy-2-furancarboxylic acid (TOFA), the specific ACC inhibitor, blocked the effect of SVS as well. During glucotoxity, ACC gene expression, ACC protein, and phosphorylated ACC protein were increased in INS-1E beta-cells. SVS pretreatment further increased ACC gene expression with strikingly elevated ACC activity and increased glucose uptake accompanied by enhanced GSIS. Our studies show that glucose is a potent stimulator of ACC and that SVS to some extent counteracts glucotoxicity via increased ACC activity. SVS possesses the potential to alleviate negative effects of glucotoxicity in beta-cells via a unique mechanism of action.     

Weight loss is not mandatory for exercise-induced effects on health indices in females with metabolic syndrome

The aim of this study was to investigate the impact of moderate aerobic training on functional, anthropometric, biochemical, and health-related quality of life (HRQOL) parameters on women with metabolic syndrome (MS). Fifteen untrained women with MS performed moderate aerobic training for 15 weeks, without modifications of dietary behaviours. Functional, anthropometric, biochemical, control diet record and HRQOL parameters were assessed before and after the training. Despite body weight maintenance, the patients presented decreases in waist circumference (P = 0.001), number of MS components (P = 0.014), total cholesterol (P = 0.049), HDL cholesterol (P = 0.004), LDL cholesterol (P = 0.027), myeloperoxidase activity (P = 0.002) and thiobarbituric acid-reactive substances levels (P = 0.006). There were no differences in total energy, carbohydrate, protein and lipid intake pre- and post-training. Furthermore, improvements in the HRQOL subscales of physical functioning (P = 0.03), role-physical (P = 0.039), bodily pain (P = 0.048), general health (P = 0.046) and social functioning scoring (P = 0.011) were reported. Despite the absence of weight loss, aerobic training induced beneficial effects on functional, anthropometric, biochemical and HRQOL parameters in women with MS.     

The effects of tin (Sn) additions on the growth of spinach plants

An increase in bioavailable tin in the environment could result in bioaccumulation thereof in agricultural crops, and therefore, have adverse health consequences on humans that eat these crops. The aims of the current study were thus to assess the uptake of Sn by spinach plants, and the subsequent effects this will have on the uptake of Na, Zn, K, Ca, and Mg as well as the growth of spinach plants. Spinach plants were grown in sand culture and received tin at concentrations of 0.02, 0.2, 2 and 20 mg/L along with a nutrient solution. The uptake of tin at detectible concentrations only occurred at the highest concentrations (2 and 20 mg/L), and it was mostly retained in the roots of the plants. Tin additions also resulted in no visual toxicity symptoms, and might be beneficial to biomass production. Further field trials are needed to ensure that these experimental results remain true under field conditions.