Tissue specific nuclear antigens in the germinal vesicle ofXenopus laevis oocytes

Summary A library of hybridoma cell lines has been established which produce monoclonal antibodies against antigens from the germinal vesicle ofXenopus laevis oocytes. Many of the antigens are also found in the nuclei ofXenopus embryonic cells in culture. The fate of two of these antigens during embryogenesis was traced by immunofluorescence on embryo and tadpole sections. Early in development these antigens appear to be evenly distributed in the nuclei of all cells. In later stages they gradually disappear from most embryonic structures but are strongly accumulated in the nuclei of some specific cell types and organs.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Photooxidation reactions of diphenylcarbazide and their DCMU-sensitivity in thylakoids of the blue-green alga Oscillatoria chalybea

Thylakoids of Oscillatoria chalybea are able to split water. The Hill reaction of these thylakoids is sensitive to DCMU. Diphenylcarbazide can substitute for water as the electron donor to photosystem II with these fully functioning thylakoids. However, the diphenylcarbazide photooxidation is completely insensitive to 3-(3,4-dichlorophenyl)-N-N-dimethyl urea (DCMU) at high diphenylcarbazide concentrations. In with Tris-treated Oscillatoria thylakoids the water splitting capacity is lost and diphenylcarbazide restores electron transport through photosystem II as occurs with higher plant chloroplasts. However, also these photoreactions are insensitive to DCMU. If diphenylcarbazide acts in Oscillatoria as an electron donor to photosystem II the result suggests that diphenylcarbazide feeds in its electrons behind the DCMU inhibition site. This in turn indicates that in Oscillatoria the site of inhibition of DCMU is on the donor side of photosystem II.Abbreviations Used DCMU 3-(3,4-dichlorophenyl)-N-N-dimethyl urea - DPC diphenylcarbazide - DCPiP 2,6-dichlorophenol indophenol - TMB tetramethyl benzidine - A-2-sulf anthraquinone-2-sulfonate     

The role of vanadium in green plants

Cells of Chlorella pyrenoidosa, derived from vanadium free agar slants, respond with great sensitivity to microamounts of vanadium, added as NH₄VO₃ to autotrophic liquid cultures. Between 0.01 and 1 g V per litre nutrient medium (2·10^-10-2·10^-8g-at/l), the algae respond with a continuous increase in dry weight. At higher V-concentrations, further enhancement in biomass is accompanied by a additional increase in chlorophyll content. Maximum V-effect on both parameters was found to be at 500g V/l (10^-5 g-at/l). Dry weight as well as chlorophyll content of Chlorella are decreased by concentrations above 25 mg V/l; 100 mg V/l (2·10^-3 g-at/l) stop growth and cause death of the cells. The toxic threshold for the V-content in the algae was determined to be at 150–200 g V/g (3–4·10^-6 g-at/g) dry weight.Two different pH-optima for a positive vanadium action on dry weight and chlorophyll biosynthesis were established, the first at pH 7, the other in the range pH 7.5–8. Two sites of vanadium action in green algae are discussed.Part I: Arch. Microbiol. 105, 77–82 (1975)     

Psoralen/UVA treatment and chromosomes

Summary Treatment of human lymphocytes in vitro with trimethylpsoralen or 8-methoxypsoralen and UVA irradiation (PUVA) induced chromosome damage, mainly constrictions and gaps, but also breaks and exchanges, and increased the frequency of sister chromatid exchange (SCE). The localization of the chromosome aberrations was nonrandom. The coincidence of many PUVA hits with mercaptoenthanol hits suggests that PUVA may have other targets in the cell than the DNA, perhaps the folding proteins of the chromosomes and the nuclear membrane/chromatin attachment organelles.Caffeine increased in a synergistic way the chromosome aberration yield if added after PUVA treatment, but there was no effect when caffeine was present before and during PUVA treatment. The SCE frequency was increased in the presence of caffeine.     

Myosin light chain patterns of individual fast and slow-twitch fibres of rabbit muscles

Summary Single muscle fibres were isolated by microdissection from freeze-dried samples of rabbit psoas and soleus muscles. The individual fibres were typed according to qualitative histochemical reactions for succinate dehydrogenase or NADH-tetrazolium reductase and for alkaline Ca²⁺-activated myofibrillar myosin ATPase after acid or alkaline preincubation. Methods are described for electrophoretic analysis by means of polyacrylamide disc electrophoresis in the presence of SDS of total myofibrillar proteins in single fibres after pre-extraction of soluble proteins. Fast-twitch white fibres revealed a myosin light chain pattern characteristic of fast-type myosin with three light chains of apparent molecular weights of 22,300 (LC₁), 18,400 (LC₂) and 16,000 (LC₃). Fast-twitch red fibres were indistinguishable in this respect from fast-twitch white fibres and showed an identical pattern of myosin light chains. Slow-twitch fibres could be characterized by a myosin light chain pattern typical of myosin of slow-twitch muscles with peptides of the apparent molecular weights of 23,500 (LC_1Sa), 23,000 (LC_1Sb) and 18,500 (LS_2S). Slow-twitch fibres isolated from soleus as well as from psoas muscle were indistinguishable with regard to their myosin light chain patterns, thus suggesting that fibres of the same histochemical type correspond in their myosin light chain patterns irrespective of their origin from different muscles.Dedicated to the memory of Ernest Gutmann who has contributed so much to our knowledge on differentiation of muscle and who died on August 6, 1977     

Phytochrome-mediated control of grana and stroma thylakoid formation in plastids of mustard cotyledons

The etioplast»chloroplast transition in the cotyledons of mustard seedlings (Sinapis alba L.) has been studied by electron microscopy. It was found that the active form of phytochrome, established by a red light pulse pretreatment, increases the initial rate and eliminates the lag of grana and stroma thylakoid formation after the onset of white light 60 h after sowing. The effect of a pretreatment with 15 s red light pulses is fully reversible by 756 nm light pulses. This reversibility is lost within 5 min. Evidence is presented which suggests that the time course of grana and stroma thylakoid formation is not correlated with the time course of the dispersal of the prolamellar body. The different functions of phytochrome and chlorophyll in controlling thylakoid formation are discussed.     

Quantitative analysis of the microtubule system in isolated fish melanophores

Isolated melanophores of the angelfish, Pterophyllum scalare, have been used in a morphometric analysis and a quantitative study of their microtubule system. Using transverse sections spaced at regular intervals, the changes associated with the process of pigment aggregation have been determined. Upon the concentration of pigment granules in the central cell region, almost half of the cytoplasmic portion is also withdrawn from the peripheral cell regions. Counts of microtubules within a cell sector in cells with pigment aggregated and dispersed, respectively, reveal (a) a constancy of the number of microtubules in this sector regardless of the distance from the cell center, and (b) a reduction of microtubule number in cells with pigment aggregated by about 58%. On the basis of these counts, the total number of microtubules has been calculated. In the dispersed state, about 2,400 microtubules extend between the center and the periphery of the cell, while their number is about 1,000 in the aggregated state. Using a 13-protofilament model of a microtubule and relevant data on size and molecular weight of microtubule subunits, the amount of tubulin present as microtubules is calculated. In the average, the cells contain 1.95·10⁸ monomers corresponding to 1.78·10^?8 mg tubulin. A tentative estimation of the concentration of tubulin inside a melanophore yields values of 6.1 mg/ml for the whole cell and 16.5 mg/ml for the cytoplasm alone (excluding membrane-bound organelles). Based on this estimation, a comparison, with microtubule assembly in vitro is made.