d-Ribulose 1,5-bisphosphate carboxylase and polyhedral inclusion bodies in Nitrosomonas spec

Polydedral inclusion bodies were isolated from exponentially grown cells of Nitrosomonas spec. The bodies contained d-ribulose, 1,5-bisphosphate carboxylase. The specific activity of the enzyme was 0.0122 mol CO₂ fixed per min per mg of protein.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Immunocytochemical identification of proctolinlike immunoreactivity in the terminal ganglion and hindgut of the cockroach Periplaneta americana (L.)

Summary In the American cockroach, the distribution and connections of neuronal elements of the terminal ganglion-proctodeal nerve-hindgut system were investigated by means of immunohistochemical methods and axonal CoCl₂ iontophoresis. Proctolinlike immunoreactivity was localized within neurons of the terminal ganglion projecting into the proctodeal nerve on the one hand, and in nerve cells without a direct connection to this system on the other. Immunohistochemically, in whole mount preparations fibres of the proctodeal nerve and terminal structures in the hindgut musculature exhibit strong proctolinlike immunoreactivity. At the light- and electron-microscopic levels the pathways of about 30 somata of the proctodeal neural system were characterized by cobalt chloride iontophoresis. The relationships of cobalt filled and immunoreactive neuronal structures are discussed.For the preparation of tritiated proctolin we thank Dr. S. Reißmann, WB Biochemie, Sektion Biologie, FSU JenaThe authors wish to thank G. Schörlitz, Film- und Bildstelle, FSU Jena, for photographs of whole mount preparations and Ms. A. Zinßer and Mrs. B. Cosack for excellent technical assistance.     

Isolation and identification of some guanidino compounds in the urine of patients with hyperargininaemia by liquid chromatography,thin-layer chromatography and gas chromatography-mass spectrometry

Liquid column chromatographic studies of monosubstituted guanidino compounds, which are excreted in the urine of patients with hyperargininaemia are reported. The guanidino-positive peaks, with the highest excretion values, were isolated from urine and the isolated compounds were identified by thin-layer chromatography and gas chromatography—mass spectrometry. Guanidinoacetic acid, N-α-acetylarginine, argininic acid, γ-guanidinobutyric acid, arginine and α-keto-δ-guanidinovaleric acid were found to be excreted at high levels in the urine of patients with hyperargininaemia compared with controls.     

Selection studies in sugarcane (Saccharum sp. hybrids)

Summary An approximate method to determine sample size for the estimation of population variance, ², is given. The estimate of ² is denoted as s² . Based on the assumption of a normal distribution for (s²/²–1), the sample size is approximately equal to 20,000 z² _p,/k²; where z is a standard normal deviate, p is the probability that s² ( 100¦s² – ²¦/²) is less than, or equal to, a critical value k, and k (measured as gDs²) is the desired precision of s² .The expected value of s², with respect to sample size, and the expected cumulative frequencies of s² over sample size for various k values are given. Their goodness of fit to the observed results was satisfactory except for populations that were different from normal. The observed values were taken from a study on four yield components in five sugarcane polycross progenies, grown in two contrasting environments over 2 years in three selection stages.The expected s² was found to be independent of the population coefficient of variance.Research suppoted in part by USDA, ARS, grant #12-14-5001-34. Published with the approval of the Director as Paper No. 412 in the Journal Series of the Experiment Station, Hawaiian Sugar Planters' Association.     

Heterogeneity of urinary oligosaccharides from mannosidosis: Mass spectrometric analysis of permethylated Man9, Man8, and Man7 derivatives

Three oligosaccharides isolated from the urine of a patient suffering from mannosidosis, a Man₉GlcNAc, a Man₈GlcNAc, and a Man₇GlcNAc, were analyzed by electron impact mass spectrometry at 20 eV after reduction with NaB²H₄ and permethylation. Molecular ions were observed at $\text{m}\text{e}$ 2144, 1940, and 1736, respectively. In the high-mass range very intense ions were found at M-45. The mass spectrum of the homogenous decasaccharide Man₉GlcNAc_1D contains ions that could be attributed to specific parts of each of the three antennae of the molecule. Thus characteristic key ions were recognized. With the aid of these key ions the spectra of the nona- and octasaccharide mixtures could be evaluated in a qualitative and a semiquantitative way. In the nonasaccharide all three possible isomers that can be produced by cleavage of one of the three terminal α-mannoses are present, although in differing amounts. However, only five of the six possible isomers of the octasaccharide could be detected.     

Difference in chromatin sensitivity to heparin of chronic atrophic gastritis, of carcinoma-free and carcinoma-bearing stomach in comparison with normal gastric mucosa and gastric carcinoma as revealed by flow cytometry

DNA distribution patterns from gastric mucosal cells corresponding to four groups defined by histological examination were measured by flow cytometry before and after treatment with heparin, a polyanion. Group I comprised normal gastric mucosal cells; group II, chronic atrophic gastric mucosal cells originating from a carcinoma free stomach; group III, chronic atrophic gastric mucosal cells originating from a carcinoma bearing stomach; and group IV, malignant gastric mucosal cells. The heparin concentrations used were 1.25, 1.5, and 5 U/ml cell suspension. Heparin caused increases in fluorescence intensity and in coefficients of variation, which are interpreted as a reflection of alterations in chromatin structure. For the four groups investigated, the heparin-initiated changes were dependent, in varying degree, on concentration and time. Group I showed a much more extensive sensitivity to heparin than group IV. Group II and III reacted similarly to group I or group IV, depending on the source, i.e., either a carcinoma-free stomach or a carcinoma-bearing stomach. Further extension of this method might yield information concerning the real premalignant potential of a specific case of chronic atrophic gastritis.     

Characterization of a variant of carcinoembryonic antigen (CEA) using monoclonal and polyclonal anti-CEA antibodies

A variant of the carcinoembryonic antigen (CEA) with lower molecular weight than a CEA reference preparation has been separated from CEA. Using a polyclonal, spleen absorbed anti-CEA antiserum, the variant crossreacts with reference CEA in immunodiffusion. The CEA-activity of the variant has been demonstrated using an enzyme-immunoassay with monoclonal CEA specific antibodies. There is sufficient immunological evidence that this variant is a distinct antigen different from the crossreactive antigens described so far. The reactivity of the polyclonal anti-CEA antiserum with the CEA variant was abolished by absorption against the immobilized variant.     

Ontogenetische Verhaltens?nderungen bei der Brandente (Tadorna tadorna): Schlafen, Tauchen, Nahrungserwerb

Zusammenfassung Brandentenküken verfügen über drei verschiedene Taucharten, die sich nach Ausführung und Tauchdauer deutlich unterscheiden lassen. Während das Nahrungstauchen in der 6. Lebenswoche eingestellt wird, bleiben Tauchbaden und Fluchttauchen lebenslang erhalten. Neben dem Nahrungstauchen werden weitere Techniken des Nahrungserwerbs in Abhängigkeit vom Nahrungsangebot und dem Entwicklungsstand unterschiedlich häufig angewendet. Der zeitliche Aufwand für die Nahrungsaufnahme ist in den ersten 2 Lebenswochen maximal. Anschließend nimmt er, bei schneller als bei kontinuierlich ab. Kälteperioden führen zu einer weiteren Reduzierung. Die Schlafhäufigkeit sinkt nach einer anfänglichen Zunahme (bis 10. Lebenswoche) ab. Kälteperioden bewirken eine Zunahme. Unter 3 verschiedenen Schlafhaltungen wird bis zur 12. Lebenswoche das Schlafen im Liegen bevorzugt. Danach nimmt es zugunsten des einbeinigen Schlafens im Stehen, das erstmals in der 7. Lebenswoche auftritt, ab. Kälteperioden stellen die ursprünglichen Häufigkeitsverhältnisse zwischen beiden Schlafhaltungen wieder her. Brandentenküken bilden in den ersten Lebenswochen Schlafhaufen. Ihre Häufigkeit sinkt bis zur 12. Lebenswoche kontinuierlich auf Null ab.

---

Ontogenetic changes in sleeping, diving and foraging behaviour in Shelduck (Tadorna tadorna) ducklings

Summary Shelduck ducklings show different types of diving behaviour: diving for food, flight-diving and dashing and diving in comfort situations. These types differ by diving duration and the behaviour of the ducks. In diving for food diving duration and frequency decrease during the first 6 weeks. After this, no food diving was observed. Other feeding methods include sieving, upending, pecking on the surface of water, feeding on plants and foot-trampling. Except for feeding on plants, which was first observed in the 10th week, all feeding methods are present in one day old ducklings. The share of foraging time is highest during the first 2 weeks of life. Afterwards it decreases (in females faster than in males) from about 50 to 20 %. During cold weather, it was still lower whereas resting and sleeping behaviour increased. After an increase during the first 10 weeks of life, the share of resting decreases to 25–40 % of observation time. Shelduck ducklings have 3 different sleeping postures: lying, standing on one leg, standing on two legs. During the first weeks of life ducklings only sleep standing on two legs or lying on the ground, the latter is being clearly preferred. Standing on one leg appeared in the 7th week. Its frequency increased and it became the most prominent resting pattern. Only during cold spells shelducks do return to sleep by lying on the ground. Under such conditions also sleeping in contact with one another reoccurs, which is typical for ducklings during their first weeks of life.