Physical mapping of plastid DNA variation among eleven Nicotiana species

Summary Plastid DNA of seven American and four Australian species of the genus Nicotiana was examined by restriction endonuclease analysis using the enzymes Sal I, Bgl I, Pst I, Kpn I, Xho I, Pvu II and Eco RI. These endonucleases collectively distinguish more than 120 sites on N. tabacum plastid DNA. The DNAs of all ten species exhibited restriction patterns distinguishable from those of N. tabacum for at least one of the enzymes used. All distinctive sites were physically mapped taking advantage of the restriction cleavage site map available for plastid DNA from Nicotiana tabacum (Seyer et al. 1981). This map was extended for the restriction endonucleases Pst I and Kpn I. In spite of variation in detail, the overall fragment order was found to be the same for plastid DNA from the eleven Nicotiana species. Most of the DNA changes resulted from small insertions/deletions and, possibly, inversions. They are located within seven regions scattered along the plastid chromosome. The divergence pattern of the Nicotiana plastid chromosomes was strikingly similar to that found in the genus Oenothera subsection Euoenothera (Gordon et al. 1982). The possible role of replication as a factor in the evolution of divergence patterns is discussed. The restriction patterns of plastid DNA from species within a continent resembled each other with one exception in each instance. The American species N. repanda showed patterns similar to those of most Australian species, and those of the Australian species N. debneyi resembled those of most American species.Abbreviations ims isonuclear male sterile - ptDNA plastid chloroplast DNA - Rubisco ribulosebisphosphate carboxylase/oxygenase - kbp kilobase pairs - LSU large subunit of Rubisco     

Isolation of methotrexate-resistant cell lines in Petunia hybrida upon stepwise selection procedure

Summary Cell suspensions of Petunia hybrida were subjected to a selection procedure in which the concentration of the selective agent, methotrexate (MTX), was gradually elevated. In mammalian cells, this procedure frequently results in MTX-resistant mutants due to amplification of the gene coding for dihydrofolate reductase (DHFR), the target protein of MTX.Five suspension lines were isolated, with degrees of resistance ranging from 10 to 500 M MTX (in wild type the LD_99.9 is 0.2 M). MTX^R phenotypes were unstable, as manifested by the loss of resistance upon prolonged growth in the absence of drug. All of the mutants also exhibited high values of MTX-binding protein (60- to 400-fold higher than that of the wild type), which declined to intermediate values upon MTX withdrawal. Finally, cellular extracts from all of the mutants also showed high specific staining of DHFR-activity in gels.The results suggest that the resistance of MTX in these plant cell-lines is mediated by the elevation of the amounts of DHFR, probably as a consequence of gene amplification.     

Peripheral nerve extract promotes long-term survival and neurite outgrowth in cultured spinal cord neurons

The hypothesis that peripheral, skeletal muscle tissue contains a trophic factor supporting central neurons has recently been investigated in vitro by supplementing the culture medium of spinal cord neurons with muscle extracts and fractions of extract. We extended these studies asking whether or not a trophic factor is present in peripheral nerves, the connecting link between muscle and central neurons via which factors may be translocated from muscle to neurons by the retrograde transport system. Lumbar, 8-day-old chick spinal cords were dissociated into single cells and then cultured in the presence of peripheral nerve extract. Cytosine arabinoside was added to inhibit proliferation of nonneuronal cells. In the presence of nerve extract, spinal cord neurons survived for more than a month, extended numerous neurites, and showed activity of choline acetyltransferase. In the absence of extract, neurons attached and survived for a few days but then died subsequently in less than 10 days. Neurite outgrowth did not occur in the absence of extract. Withdrawal of extract from the medium of established neuronal cultures caused progressive loss of both cells and neurites. Other tissues also contained neuron supporting activity but less than that found in nerve extract. These studies indicate that peripheral nerves contain relatively high levels of spinal cord neuron-directed trophic activity, suggesting translocation of neurotrophic factor from muscle to central target neurons. The neurotrophic factor has long-term (weeks) effects, whereas short-term (days) survival is factor independent.     

Procedure for the identification of Escherichia coli mutants affected in components containing glycerol derived from phospholipid turnover: Isolation of mutants lacking glycerol in membrane-derived oligosaccharides (MDO)

Abstract A mutant screening procedure is described which allows the identification of mutants carrying lesions in lipoprotein, membrane-derived oligosac-charides (MDO), and other compounds of the E. coli cell envelope containing glycerol derived from phospholipid metabolism. Two mutants lacking glycerol in MDO and one mutant devoid of lipoprotein demonstrate the usefulness of the procedure.     

Molecular cloning of the ribosomal RNA genes of the photosynthetic bacterium Rhodopseudomonas capsulata

Summary Chromosomal segments of Rhodopseudomonas capsulata carrying the ribosomal operons and cloned with the cosmid vector pHC79 have been identified by cross hybridization with ³²P-ATP labeled rRNAs. At least seven rRNA operons are present in the R. capsulata chromosome. By R-loop analyses of DNA-RNA hybrids, two distinct loop structures of sizes 1.50 kb and 2.52 kb corresponding to the 16S and 23S RNA molecules, respectively, were detected. Intact 23S RNA molecules can be isolated from R. capsulata ribosomes by sucrose density centrifugation. However, fragmentation of the 23S RNA molecule into a 16S-like molecule was observed during gel electrophoresis. Restriction mapping and hybridization of a 9 kb PstI fragment that contained one copy of the rRNA operon showed the following sequence of the RNA genes in R. capsulata 16S, 23S, and 5S. A spacer region of 0.91 kb was found between the 16S and the 23S RNA genes.     

Combining ability and parental evaluation in five selected clones of sugarcane (Saccharum sp. hybrids)

Summary Five Hawaiian commercial sugarcane (Saccharum sp. hybrids) clones were crossed in a full diallel. Four morphological characters were studied in the progeny: number of millable stalks per plant, stalk diameter, stalk length, and sucrose content. A fifth character, plant volume, was calculated from stalk number, stalk diameter and stalk length. The five selected parental clones were treated as fixed variables in the analysis. General combining ability (gca) was significant for all five characters; specific combining ability (sca) was significant for stalk diameter, stalk length, and plant volume. The variance for gca was large in all progeny populations. However, the variance for sca was large in the progeny of only some clones and/or for some individual characters. Parents were evaluated on the basis of their general combining ability: clone H49-3533 had high gca for sucrose content, while clone H53-5356 had high gca for plant vigor.Published with the approval of the Director as Journal Series Paper No. 455, Experiment Station, Hawaiian Sugar Planters' Association.     

Ribosomal DNA of the fly Sciara coprophila has a very small and homogeneous repeat unit

Summary In this report we show by hybridization of restriction fragments and by Miller spreads that the unit repeat of the fly Sciara coprophila is only 8.4 kb which is the smallest known for a multicellular eukaryote. The 8.4 kb EcoR1 fragment containing a complete unit of Sciara rDNA was cloned in pBR322, and mapped by the method of Parker (1977) and also by double digestion. The coding regions for 28S, 18S, and 5.8S RNA were localized by the method of Berk and Sharp (1977). From these data we conclude that the nontranscribed spacer, external transcribed spacer, and internal transcribed spacer are all shorter than in other organisms, thereby giving rise to the shorter overall rDNA repeat unit of Sciara.At least 90% of the Sciara rDNA repeats are homogeneous, with a length of 8.4 kb, but a 700 bp ladder of minor bands can also be found in digestions of total genome DNA. This profile of major and minor bands is identical between the X and X chromosomes, as seen by a comparison of several genotypes.There are only 45 rRNA genes per X chromosome of Sciara (Gerbi and Crouse, 1976). These can easily be counted by low magnification Miller speads which show that virtually all gene copies are actively being transcribed in the stage of spermatogenesis examined. This is the first demonstration for any reiterated gene family where all copies are shown to be simultaneously active.Present address same as last author     

d-Ribulose 1,5-bisphosphate carboxylase and polyhedral inclusion bodies in Nitrosomonas spec

Polydedral inclusion bodies were isolated from exponentially grown cells of Nitrosomonas spec. The bodies contained d-ribulose, 1,5-bisphosphate carboxylase. The specific activity of the enzyme was 0.0122 mol CO₂ fixed per min per mg of protein.     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.