Proteinase Inhibitor II Gene Expression Induced by Electrical Stimulation and Control of Photosynthetic Activity in Tomato Plants

Mechanical damage and heat stimulation were used to activateproteinase inhibitor II (Pin2) gene expression in tomato plantsin both treated (local induction) and non-treated tissues (systemicinduction). Both stimuli have been shown to generate electricalsignals, leading to a systemic activation of gene expression.Treatment of tomato leaves with electrical current resultedin the accumulation of Pin2 mRNA in the local and systemic leaves.Additionally, all treatments inducing Pin2 gene activity gaverise to a significant alteration of stomatal aperture. However,heat stimulation provoked a different response in the stomatalparameters than mechanical wounding or electric treatment. Bothmechanical damage and electrical stimulation activated two characteristictime constants in the gas exchange relaxation kinetics. Conversely,heat stimulation resulted in only one major time constant. Theresults clearly show that direct current application to tomatoleaves initiates Pin2 mRNA accumulation locally and systemically.In addition, they suggest the participation of a second slowelectrical/hydraulic component in the wound response mechanismof tomato plants and a possible alternative pathway regulatingheat-induced Pin2 gene expression. (Received February 13, 1995; Accepted April 14, 1995)     

Increases in α-mannosidase activity in the arbuscular mycorrhizal symbiosis of Allium schoenoprasum

 Mycorrhizal and nonmycorrhizal roots of Allium schoenoprasum were tested for activities of α-mannosidase, β-glucosidase and arabinosidase. Mannosidase activity was higher by a factor of two in mycorrhizal than in nonmycorrhizal root extracts. The apparent molecular weight of the enzyme was 152 kDa and its K_M was 1.25 mM in colonized roots and 1.85 mM in uncolonized roots. α-Mannosidase activity was further characterized by an acid pH optimum and Zn²⁺ dependency. No significant differences could be found between mycorrhizal and nonmycorrhizal roots for β-glucosidase and arabinosidase activities. Accepted: 28 August 1995     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Enhancement of specific nitrogenase activity inAzospirillum brasilense andKlebsiella pneumoniae,inhibition inRhizobium japonicum under air by phenol

Specific nitrogenase activity inAzospirillum brasilense ATCC 29145 in surface cultures under air is enhanced from about 50 nmol C₂H₄·mg protein^-1·h^-1 to 400 nmol C₂H₄ by the addition of 1 mM phenol. 0.5 and 2 mM phenol added increase the rate 5-fold and 4-fold. This enhancement effect is observed only between 2 and 3 days after inoculation, with only a small reduction of the growth of the cells by the phenol added. In surface cultures under 1% O₂, nitrogenase activity is slightly reduced by the addition of 1–0.01 mM phenol. Utilization of succinate is enhanced during the period of maximum enhancement of nitrogenase activity by 60% by addition of 1 mM phenol. The cells did not produce¹⁴CO₂ from [U-¹⁴C] phenol, neither in surface cultures nor in liquid cultures and less than 0.1% of the phenol was incorporated into the cells. A smaller but significant enhancement of nitrogenase activity by about 100% in surface cultures under air was found withKlebsiella pneumoniae K 11 after addition of 1 mM phenol. However, inRhizobium japonicum 61-A-101 all phenol concentrations above 0.01 mM reduced nitrogenase activity. With 1 mM phenol added activity was reduced to less than 10% with no effect on the growth in the same cultivation system. With thisRhizobium japonicum strain significant quantities of phenol (25 mol in 24 h by 2·10¹² cells) were metabolized to¹⁴CO₂, with phenol as sole carbon source. WithAzospirillum brasilense in liquid culture under 1% and 2% O₂ in the gas phase, no enhancement of nitrogenase activity by phenol was noticed.     

Palynology of the perigoniate Aroideae: Zamioculcas,Gonatopus and Stylochaeton (Araceae)

The pollen of the perigoniate Aroideae sensu Mayo et al. (1997) ( Zamioculcas Schott, Gonatopus Hook. f. ex Engl. and Stylochaeton Lepr.) differs ultrastructurally from that of the aperigoniate Aroideae in several important exine and aperture characters. The almost identical zona-aperturate pollen of Zamioculcas and Gonatopus has outside the aperture an elaborated, thick ectexine, while the aperture consists of a thin, but continuous ectexine and a thick, lamellate endexine. In contrast, the omniaperturate pollen of Stylochaeton has a thin, not clearly stratified ectexine and a thin, heterogeneous endexine below. However, the zona-aperturate pollen of Zamioculcas and Gonatopus deviates significantly from the superficially similar zona-aperturate pollen of the unrelated Monstereae (e. g., Monstera Adans., Amydrium Schott): in the apertures of Monstera or Amydrium both the thin, but continuous ectexine and the lamellate endexine, which are typical features for Zamioculcas and Gonatopus , are absent. The palynological data underline not only the present classification of Zamioculcas , Gonatopus and of Stylochaeton into two tribes (Zamioculcadeae and Stylochaetoneae) and the differences of both tribes from the other Aroideae, but show also significant deviations in the respective zona-aperturate condition in Monstereae (Monsteroideae) and Zamioculcadeae (Aroideae).     

Successful bone marrow transplantation in a patient with DNA ligase IV deficiency and bone marrow failure

Cirrhotic cardiomyopathy is the term used to describe a constellation of features indicative of abnormal heart structure and function in patients with cirrhosis. These include systolic and diastolic dysfunction, electrophysiological changes, and macroscopic and microscopic structural changes. The prevalence of cirrhotic cardiomyopathy remains unknown at present, mostly because the disease is generally latent and shows itself when the patient is subjected to stress such as exercise, drugs, hemorrhage and surgery. The main clinical features of cirrhotic cardiomyopathy include baseline increased cardiac output, attenuated systolic contraction or diastolic relaxation in response to physiologic, pharmacologic and surgical stress, and electrical conductance abnormalities (prolonged QT interval). In the majority of cases, diastolic dysfunction precedes systolic dysfunction, which tends to manifest only under conditions of stress. Generally, cirrhotic cardiomyopathy with overt severe heart failure is rare. Major stresses on the cardiovascular system such as liver transplantation, infections and insertion of transjugular intrahepatic portosystemic stent-shunts (TIPS) can unmask the presence of cirrhotic cardiomyopathy and thereby convert latent to overt heart failure. Cirrhotic cardiomyopathy may also contribute to the pathogenesis of hepatorenal syndrome. Pathogenic mechanisms of cirrhotic cardiomyopathy are multiple and include abnormal membrane biophysical characteristics, impaired β-adrenergic receptor signal transduction and increased activity of negative-inotropic pathways mediated by cGMP. Diagnosis and differential diagnosis require a careful assessment of patient history probing for excessive alcohol, physical examination for signs of hypertension such as retinal vascular changes, and appropriate diagnostic tests such as exercise stress electrocardiography, nuclear heart scans and coronary angiography. Current management recommendations include empirical, nonspecific and mainly supportive measures. The exact prognosis remains unclear. The extent of cirrhotic cardiomyopathy generally correlates to the degree of liver insufficiency. Reversibility is possible (either pharmacological or after liver transplantation), but further studies are needed.     

Time-dependent changes in myosin heavy chain mRNA and protein isoforms in unloaded soleus muscle of rat

Time-dependent changes in myosin heavy chain(MHC) isoform expression were investigated in rat soleus muscleunloaded by hindlimb suspension. Changes at the mRNA level weremeasured by RT-PCR and correlated with changes in the pattern of MHCprotein isoforms. Protein analyses of whole muscle revealed that MHCIdecreased after 7 days, when MHCIIa had increased, reaching a transient maximum by 15 days. Longer periods led to inductions and progressive increases of MHCIId(x) and MHCIIb. mRNA analyses of whole muscle showedthat MHCIId(x) displayed the steepest increase after 4 days andcontinued to rise until 28 days, the longest time period investigated.MHCIIb mRNA followed a similar time course, although at lower levels.MHCI mRNA, present at extremely low levels in control soleus, peakedafter 4 days, stayed elevated until 15 days, and then decayed.Immunohistochemistry of 15-day unloaded muscles revealed that MHCIwas present in muscle spindles but at low amounts also in extrafusalfibers. The slow-to-fast transitions thus seem to proceed in the orderMHCI  MHCIIa  MHCIId(x)  MHCIIb. Ourfindings indicate that MHCI is transiently upregulated in somefibers as an intermediate step during the transition from MHCI to MHCIIa.

     

Plant virus expression systems for transient production of recombinant allergens in Nicotiana benthamiana

In recent years, several studies have demonstrated the use of autonomously replicating plant viruses as vehicles to express a variety of therapeutic molecules of pharmaceutical interest. Plant virus vectors for expression of heterologous proteins in plants represent an attractive biotechnological tool to complement the conventional production of recombinant proteins in bacterial, fungal, or mammalian cells. Virus vectors are advantageous when high levels of gene expression are desired within a short time, although the instability of the foreign genes in the viral genome may present problems. Similar levels of foreign protein production in transgenic plants often are unattainable, in some cases because of the toxicity of the foreign protein. Now virus-based vectors are for the first time investigated as a means of producing recombinant allergens in plants. Several plant virus vectors have been developed for the expression of foreign proteins. Here, we describe the utilization of tobacco mosaic virus- and potato virus X-based vectors for the transient expression of plant allergens in Nicotiana benthamiana plants. One approach involves the inoculation of tobacco plants with infectious RNA transcribed in vitro from a cDNA copy of the recombinant viral genome. Another approach utilizes the transfection of whole plants from wounds inoculated with Agrobacterium tumefaciens containing cDNA copies of recombinant plus-sense RNA viruses.