Mechanisms for resistance to anticancer agents and the reversal of the resistance

MDR results from overexpression of P-glycoprotein (Pgp) and multidrug resistance protein (MRP or MRP1) that function as ATP-dependent efflux pumps. Lung resistance related protein (LRP) is also supposed to be involved in MDR. The human canalicular multispecific organic anion transporter (cMOAT) gene that is responsible for the defects in Dubin-Johnson syndrome was isolated. cMOAT is homologous to MRP1 and supposed to be involved in drug resistance. Human cMOAT cDNA transfected LLC-PK1 cells, LLC/cMOAT-1, have increased resistance to vincristine (VCR), 7-ethyl-10-hydroxycamptothecin (SN-38), and cisplatin. The multidrug resistance (MDR)-reversing agents, cyclosporin A (CsA) and PAK-104P, almost completely reversed the resistance to VCR, SN-38 and cisplatin of LLC/cMOAT-1 cells by interacting with the substrate binding site of cMOAT. Treatment of human colorectal carcinoma SW-620 cells with sodium butyrate(NaB) induced LRP in the cells and conferred resistance to Adrianycin(ADM), VCR, VP-16, gramicidin D and taxol. Two LRP-specific ribozymes inhibited the NaB-induced expression of LRP in SW-620 cells and almost completely abolished their acquisition of the MDR phenotype. The accumulation of ADM, VCR and taxol was not decreased in NaB-treated cells, suggesting that ATP-binding cassette transporters are not involved in the MDR of NaB-treated cells. ADM was mainly located in the nuclei of untreated and the cytoplasm of NaB-treated cells. The accumulation level of ADM in the nuclei isolated from untreated cells or those from treated cells in the presence of anti-LRP polyclonal antibody was higher than that from treated cells in the absence of the antibody. Efflux of ADM from nuclei isolated from NaB-treated cells was enhanced compared with those from untreated cells and NaB-treated cells transfected with a LRP-specific ribozyme. The polyclonal antibody against LRP inhibited the enhanced efflux of ADM from nuclei isolated from NaB-treated cells. These findings indicate that LRP is involved in resistance to ADM, VCR, VP-16, taxol and gramicidin D, and has an important role in the transport of ADM from the nucleus to the cytoplasm.     

Redox control of catalytic activities of membrane-associated protein tyrosine kinases

Protein tyrosine kinases (PTKs) play key roles in starting the signal transduction network for cellular development and functions. A number of both receptor-type and non-receptor-type PTKs, which are normally at a resting state, are initially activated in association with functions of the cell membrane and membrane rafts. Results of recent studies have suggested that these membrane-associated mechanisms for activation of PTKs consist of the two steps that are under redox control. The first step is activation of cell surface receptors through chemical crosslinkage or aggregation of receptors and membrane rafts, which leads to production of reactive oxygen species (ROS) as second messengers of intracellular signal transduction. The second step involves chemical modification of PTKs at the highly conserved cysteine in the MXXCW motif as a global switch for starting the tyrosine phosphorylation-dependent local switch for activation of the catalytic activity of the enzyme.     

Thymidine phosphorylase suppresses Fas-induced apoptotic signal transduction independent of its enzymatic activity

Thymidine phosphorylase (TP) has chemotactic and angiogenic activities resulting from its enzymatic activity in vitro, and it also promotes tumor growth and inhibits apoptosis in vivo. Recently, we have reported that TP plays an important role in Fas-induced apoptosis. Caspase-8 cleavage, subsequent cytochrome c release, and caspase-3 cleavage were prevented in KB cells transfected with a TP cDNA (KB/TP cells). In this study, treatment with thymidine phosphorylase inhibitor (TPI) or thymidine did not affect cell survival of KB/TP cells during Fas-induced apoptosis. Moreover, treatment with thymine or 2-deoxy-D-ribose (degradation products of thymidine generated by TP) also did not affect cell survival of control transfectant (KB/CV) cells during Fas-induced apoptosis. These findings indicate that TP suppresses Fas-induced apoptotic signal transduction independent of its enzymatic activity.     

Stepwise formation of alpha-helices during cytochrome c folding

Two models have been proposed to describe the folding pathways of proteins. The framework model assumes the initial formation of the secondary structures whereas the hydrophobic collapse model supposes their formation after the collapse of backbone structures. To differentiate between these models for real proteins, we have developed a novel CD spectrometer that enables us to observe the submillisecond time frame of protein folding and have characterized the timing of secondary structure formation in the folding process of cytochrome c (cyt c). We found that approximately 20% of the native helical content was organized in the first phase of folding, which is completed within milliseconds. Furthermore, we suggest the presence of a second intermediate, which has alpha-helical content resembling that of the molten globule state. Our results indicate that many of the alpha-helices are organized after collapse in the folding mechanism of cyt c.     

Analysis of dofA,a fruA-dependent developmental gene,and its homologue,dofB, in Myxococcus xanthus

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.     

Osteoclast differentiation factor acts as a multifunctional regulator in murine osteoclast differentiation and function.

Osteoclast differentiation factor (ODF), a novel member of the TNF ligand family, is expressed as a membrane-associated protein by osteoblasts/stromal cells. The soluble form of ODF (sODF) induces the differentiation of osteoclast precursors into osteoclasts in the presence of M-CSF. Here, the effects of sODF on the survival, multinucleation, and pit-forming activity of murine osteoclasts were examined in comparison with those of M-CSF and IL-1. Osteoclast-like cells (OCLs) formed in cocultures of murine osteoblasts and bone marrow cells expressed mRNA of RANK (receptor activator of NF-kappaB), a receptor of ODF. The survival of OCLs was enhanced by the addition of each of sODF, M-CSF, and IL-1. sODF, as well as IL-1, activated NF-kappaB and c-Jun N-terminal protein kinase (JNK) in OCLs. Like M-CSF and IL-1, sODF stimulated the survival and multinucleation of prefusion osteoclasts (pOCs) isolated from the coculture. When pOCs were cultured on dentine slices, resorption pits were formed on the slices in the presence of either sODF or IL-1 but not in that of M-CSF. A soluble form of RANK as well as osteoprotegerin/osteoclastogenesis inhibitory factor, a decoy receptor of ODF, blocked OCL formation and prevented the survival, multinucleation, and pit-forming activity of pOCs induced by sODF. These results suggest that ODF regulates not only osteoclast differentiation but also osteoclast function in mice through the receptor RANK.     

Novel Classification of the Posterior Auricular Artery Based on Angiographical Appearance

Purpose

To investigate the length variation of the posterior auricular artery and propose a novel classification of the posterior auricular artery based on angiographical appearance.

Patients and Methods

A series of 234 consecutive patients who had undergone conventional cerebral angiography was analyzed. The posterior auricular artery was examined on the lateral projection of the external carotid or common carotid arteriography. The posterior auricular artery was classified into four groups by length, using the external auditory canal and the top of the helix as radiographical landmarks. Our proposed classification is as follows: Type A, posterior auricular artery terminates between its origin and the center of the external auditory canal; Type B, posterior auricular artery terminates between the center of the external auditory canal and the top of the helix; Type C, posterior auricular artery terminates between the top of the helix and the vertex; and Type D, posterior auricular artery reaches up to the vertex.

Results

A total of 424 (right, 214; left, 210) posterior auricular arteries were analyzed in 111 men and 123 women aged 11 to 91 years (mean, 61.0 years) examined for aneurysms in 78 cases, occlusive vascular diseases in 56, intracranial hemorrhages in 41, tumors in 35, and others in 24. Types A, B, C, and D were found in 15.1%, 34.9%, 48.8%, and 1.2% of the patients, respectively.

Conclusion

A novel classification of the posterior auricular artery identifies four types based on its length on cerebral angiography.     

Habitat characteristics influencing distribution of the freshwater mussel Pronodularia japanensis and potential impact on the Tokyo bitterling, Tanakia tanago

The physical habitat characteristics associated with spatial distribution patterns of the freshwater mussel Pronodularia japanensis, which is used for oviposition by the Tokyo bitterling Tanakia tanago, were investigated in a small stream within a Tokyo bitterling protected area. The distribution of the mussels was found to be in an under-dispersed, non-random spatial pattern. Mussel occurrence correlated negatively with sediment softness, and positively with flow velocity, while mussel abundance was associated negatively with sediment softness and positively with sediment type (particle size). Furthermore, mussels were scarce in riverbed areas with a lack of sediment. These correlations suggest that the population dynamics of mussels and Tokyo bitterling may be influenced by changes in stream sediment conditions. To conserve the symbiosis between Tokyo bitterlings and mussels, a suitable benthic environment is required.