Software tools for analyzing pairwise alignments of long sequences.

Pairwise comparison of long stretches of genomic DNA sequence can identify regions conserved across species, which often indicate functional significance. However, the novel insights frequently must be windowed from a flood of information; for instance, running an alignment program on two 50-kilobase sequences might yield over a hundred pages of alignments. Direct inspection of such a volume of printed output is infeasible, or at best highly undesirable, and computer tools are needed to summarize the information, to assist in its analysis, and to report the findings. This paper describes two such software tools. One tool prepares publication-quality pictorial representations of alignments, while another facilitates interactive browsing of pairwise alignment data. Their effectiveness is illustrated by comparing the beta-like globin gene clusters between humans and rabbits. A second example compares the chloroplast genomes of tobacco and liverwort.     

Cell surface distribution and intracellular fate of asialoglycoproteins: a morphological and biochemical study of isolated rat hepatocytes and monolayer cultures

A combination of biochemistry and morphology was used to demonstrate that more than 95 percent of the isolated rat hepatocytes prepared by collagenase dissociation of rat livers retained the pathway for receptor-mediated endocytosis of asialoglycoproteins (ASGPs). Maximal specific binding of (125)I-asialoorosomucoid ((125)I-ASOR) to dissociated hepatocytes at 5 degrees C (at which temperature no internalization occurred) averaged 100,000-400,000 molecules per cell. Binding, uptake, and degredation of (125)I- ASOR at 37 degrees C occurred at a rate of 1 x 10(6) molecules per cell over 2 h. Light and electron microscopic autoradiography (LM- and EM-ARG) of (125)I-ASOR were used to visualize the surface binding sites at 5 degrees C and the intracellular pathway at 37 degrees C. In the EM-ARG experiments, ARG grains corresponding to (125)I-ASOR were distributed randomly over the cell surface at 5 degrees C but over time at 37 degrees C were concentrated in the lysosome region. Cytochemical detection of an ASOR-horseradish peroxidase conjugate (ASOR-HRP) at the ultrastructural level revealed that at 5 degrees C this specific ASGP tracer was concentrated in pits at the cell surface as well as diffusely distributed along the rest of the plasma membrane. Such a result indicates that redistribution of ASGP surface receptors had occurred. Because the number of surface binding sites of (125)I-ASOR varied among cell preparations, the effect of collagenase on (125)I-ASOR binding was examined. When collagenase-dissociated hepatocytes were re-exposed to collagenase at 37 degrees C, 10-50 percent of control binding was observed. However, by measuring the extent of (125)I-ASOR binding at 5 degrees C in the same cell population before and after collagenase dissociation, little reduction in the number of ASGP surface receptors was found. Therefore, the possibility that the time and temperature of the cell isolations allowed recovery of cell surface receptors following collagenase exposure was tested. Freshly isolated cells, dissociated cells that were re-exposed to collagenase, and perfused livers exposed to collagenase without a Ca(++)-free pre-perfusion, were found to bind 110-240 percent more(125)I-ASOR after 1 h at 37 degrees C that they did at 0 time. This recovery of surface ASGP binding activity occurred in the absence of significant protein synthesis (i.e., basal medium or 1 mM cycloheximide). Suspensions of isolated, unpolarized hepatocytes were placed in monolayer culture for 24 h and confluent cells were demonstrated to reestablish morphologically distinct plasma membrane regions analogous to bile canalicular, lateral, and sinusoidal surfaces in vivo. More than 95 percent of these cells maintained the capacity to bind, internalize, and degrade (125)I-ASOR at levels comparable to those of the freshly isolated population. ASOR-HRP (at 5 degrees C) was specifically bound to all plasma membrane surfaces of repolarized hepatocytes (cultured for 24 h) except those lining bile canalicular-like spaces. Thus, both isolated, unpolarized hepatocytes and cells cultured under conditions that promote morphological reestablishment of polarity maintain the pathway for receptor- mediated endocytosis of ASGPs.     

The nucleotide sequence of rabbit embryonic globin gene beta 3

The nucleotide sequence of a rabbit embryonic globin gene, beta 3, has been determined from 161 base pairs (bp) on the 5' side of the mRNA cap site to 209 base pairs beyond the 3' poly A addition site. The 5' and 3' ends of mRNA from both embryonic globin genes beta 3 and beta 4 have been determined by an S1 protection assay. Sequences that are highly conserved in the 5' flanking region of eukaryotic structural genes, AATAAAA and CCAAT, are located -25 to -31 nucleotides and -81 to -85 nucleotides, respectively, before the cap site. The CCAAT sequence is duplicated at -108 to -112 nucleotides, as it is in the human fetal gamma-globin genes. Small (124 bp) and large (817 bp) intervening sequences are located between codons 30 and 31 and between 104 and 105, respectively. The sequence AATAAA precedes the predominant poly(A) addition site by 19 nucleotides. Although rabbit globin gene beta 3 is transcribed and translated almost exclusively in embryonic erythrocytes, it shares striking homology with the human gamma-globin genes which are expressed in erythrocytes from fetal liver. The evolutionary conservation of rabbit beta 3 and human gamma correlates well with their similar chromosomal positions in the two genes families.     

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.     

The zebrafish gene claudinj is essential for normal ear function and important for the formation of the otoliths

We have identified a mutation in the zebrafish gene claudinj generated by retroviral integration. Mutant embryos display otoliths severely reduced in size, no response to tapping stimulus, and an inability to balance properly suggesting vestibular and hearing dysfunction. Antisense in situ hybridization to the cldnj gene showed expression first in the otic placode and later asymmetric expression in the otic vesicle. Morpholino inhibition of claudinj expression showed similar defects in otolith formation. Phylogenetic analysis of claudin sequences from multiple species demonstrates that claudinj was part of a gene expansion that began in the common ancestor of fish and humans, but additional fish specific gene duplications must have also occurred.     

Hip joint replacement surgery for idiopathic osteoarthritis aggregates in families

In order to determine whether there is a genetic component to hip or knee joint failure due to idiopathic osteoarthritis (OA), we invited patients (probands) undergoing hip or knee arthroplasty for management of idiopathic OA to provide detailed family histories regarding the prevalence of idiopathic OA requiring joint replacement in their siblings. We also invited their spouses to provide detailed family histories about their siblings to serve as a control group. In the probands, we confirmed the diagnosis of idiopathic OA using American College of Rheumatology criteria. The cohorts included the siblings of 635 probands undergoing total hip replacement, the siblings of 486 probands undergoing total knee replacement, and the siblings of 787 spouses. We compared the prevalence of arthroplasty for idiopathic OA among the siblings of the probands with that among the siblings of the spouses, and we used logistic regression to identify independent risk factors for hip and knee arthroplasty in the siblings. Familial aggregation for hip arthroplasty, but not for knee arthroplasty, was observed after controlling for age and sex, suggesting a genetic contribution to end-stage hip OA but not to end-stage knee OA. We conclude that attempts to identify genes that predispose to idiopathic OA resulting in joint failure are more likely to be successful in patients with hip OA than in those with knee OA.