Precision and accuracy of Dahl-Lea back-calculated smolt lengths from adult scales of Atlantic salmon Salmo salar

Using tagged and recaptured Atlantic salmon Salmo salar (n = 106) the present analysis shows that the most commonly applied linear back-calculation method for estimating past length, the Dahl-Lea method, resulted in overestimation of the length of large smolts and underestimation of small smolts. A correction equation (y = 0.53x + 6.23) for estimating true smolt length (y) from lengths back-calculated from adult scale measures (x) to account for these systematic discrepancies is proposed.     

Using continuous directed evolution to improve enzymes for plant applications

Continuous directed evolution of enzymes and other proteins in microbial hosts is capable of outperforming classical directed evolution by executing hypermutation and selection concurrently in vivo, at scale, with minimal manual input. Provided that a target enzyme’s activity can be coupled to growth of the host cells, the activity can be improved simply by selecting for growth. Like all directed evolution, the continuous version requires no prior mechanistic knowledge of the target. Continuous directed evolution is thus a powerful way to modify plant or non-plant enzymes for use in plant metabolic research and engineering. Here, we first describe the basic features of the yeast (Saccharomyces cerevisiae) OrthoRep system for continuous directed evolution and compare it briefly with other systems. We then give a step-by-step account of three ways in which OrthoRep can be deployed to evolve primary metabolic enzymes, using a THI4 thiazole synthase as an example and illustrating the mutational outcomes obtained. We close by outlining applications of OrthoRep that serve growing demands (i) to change the characteristics of plant enzymes destined for return to plants, and (ii) to adapt (“plantize”) enzymes from prokaryotes—especially exotic prokaryotes—to function well in mild, plant-like conditions.

Continuous directed evolution using the yeast OrthoRep system is a powerful way to improve enzymes for use in plant engineering as illustrated by “plantizing” a bacterial thiamin synthesis enzyme.     

Contrasting responses by basal ganglia met-enkephalin systems to low and high doses of methamphetamine in a rat model

The influence of methamphetamine (METH) on basal ganglia met-enkephalin (Menk) was studied by determining levels of this peptide in striatal, pallidal and nigral regions after administering a single low (0.5 mg/kg) or high (10 mg/kg) dose of this stimulant. The Menk levels in the striatal and pallidal areas were reduced and increased after the low- and high-dose METH treatments, respectively, 12 h after drug administration in all striatal and pallidal regions examined. The low-dose effect appeared to be principally influenced by increased activation of the dopamine D2-like receptor, while the high-dose effect seemed to result from dominance of D1-like receptor activation. However, both effects required coactivation of D1- and D2-like receptors. For the most part, both low- and high-dose METH-induced changes in Menk tissue content were fully recovered by 24 h. The Menk levels were not significantly altered in the substantia nigra 3-24 h after either METH treatment. Results reported herein indicated that striatal and pallidal Menk pathways respond differently after acute treatment with low or high doses of METH.     

The envelope glycoprotein of friend spleen focus-forming virus covalently interacts with and constitutively activates a truncated form of the receptor tyrosine kinase Stk

The Friend spleen focus-forming virus (SFFV) encodes a unique envelope glycoprotein, gp55, which allows erythroid cells to proliferate and differentiate in the absence of erythropoietin (Epo). SFFV gp55 has been shown to interact with the Epo receptor complex, causing constitutive activation of various signal-transducing molecules. When injected into adult mice, SFFV induces a rapid erythroleukemia, with susceptibility being determined by the host gene Fv-2, which was recently shown to be identical to the gene encoding the receptor tyrosine kinase Stk/Ron. Susceptible, but not resistant, mice encode not only full-length Stk but also a truncated form of the kinase, sf-Stk, which may mediate the biological effects of SFFV infection. To determine whether expression of SFFV gp55 leads to the activation of sf-Stk, we expressed sf-Stk, with or without SFFV gp55, in hematopoietic cells expressing the Epo receptor. Our data indicate that sf-Stk interacts with SFFV gp55 as well as gp55(P), the biologically active form of the viral glycoprotein, forming disulfide-linked complexes. This covalent interaction, as well as noncovalent interactions with SFFV gp55, results in constitutive tyrosine phosphorylation of sf-Stk and its association with multiple tyrosine-phosphorylated signal-transducing molecules. In contrast, neither Epo stimulation in the absence of SFFV gp55 expression nor expression of a mutant of SFFV that cannot interact with sf-Stk was able to induce tyrosine phosphorylation of sf-Stk or its association with any signal-transducing molecules. Covalent interaction of sf-Stk with SFFV gp55 and constitutive tyrosine phosphorylation of sf-Stk can also be detected in an erythroleukemia cell line derived from an SFFV-infected mouse. Our results suggest that SFFV gp55 may mediate its biological effects in vivo by interacting with and activating a truncated form of the receptor tyrosine kinase Stk.     

A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

Identification and characterization of SirA, an iron-regulated protein from Staphylococcus aureus

The acquisition of iron by pathogenic bacteria is often a crucial step in establishing infection. To accomplish this, many bacteria, including Staphylococcus aureus, produce low-molecular-weight iron-chelating siderophores. However, the secretion and transport of these molecules in gram-positive organisms are poorly understood. The sequence, organization, and regulation of genes involved in siderophore transport are conserved among gram-negative bacteria. We used this information to identify a putative siderophore transport locus from an S. aureus genomic sequence database. This locus contains three predicted open reading frames with a high degree of homology to genes involved in siderophore uptake in several bacterial species, in particular the cbr locus of the plant pathogen Erwinia chrysanthemi. The first gene in the locus, which we have designated sir for staphylococcal iron regulated, encodes a putative lipoprotein with a molecular mass of 37 kDa. The open reading frame is preceded by a 19-bp region of dyad symmetry with homology for operator sequences controlling iron-regulated expression of genes in other bacteria. Fur titration experiments indicate that this region of dyad symmetry is sufficient for Fur-dependent regulation in Escherichia coli. The expression of this gene was repressed, in a dose-dependent manner, by the addition of iron to the S. aureus culture medium. sir-encoded proteins may be involved in iron acquisition in vivo and therefore may be targets for antimicrobial agents.     

Linking toluene degradation with specific microbial populations in soil

Phospholipid fatty acid (PLFA) analysis of a soil microbial community was coupled with (13)C isotope tracer analysis to measure the community's response to addition of 35 microg of [(13)C]toluene ml of soil solution(-1). After 119 h of incubation with toluene, 96% of the incorporated (13)C was detected in only 16 of the total 59 PLFAs (27%) extracted from the soil. Of the total (13)C-enriched PLFAs, 85% were identical to the PLFAs contained in a toluene-metabolizing bacterium isolated from the same soil. In contrast, the majority of the soil PLFAs (91%) became labeled when the same soil was incubated with [(13)C]glucose. Our study showed that coupling (13)C tracer analysis with PLFA analysis is an effective technique for distinguishing a specific microbial population involved in metabolism of a labeled substrate in complex environments such as soil.