A study of 45,X/46,XX mosaicism in Turner syndrome females: a novel primer pair for the (CAG)n repeat within the androgen receptor gene

This paper describes the procedures developed for the determining of diparental/uniparental origin of X chromosomes in mosaic Turner females (karyotype 45,X/46,XX), and accounts for results of the analysis of chromosomal material from 20 girls with Turner syndrome. An (CAG)n repeat within the androgen receptor (AR) gene was selected as a genetic marker. A novel primer pair for amplification of the (CAG)12-30 repeat was designed. These primers gave an amplification product of 338 bp in length and were following (5'-->3'): agttagggctgggaagggtc and cggctgtgaaggttgctgt. Nineteen of the subjects were heterozygous for the selected marker. In 4 cases there were distinct signals from three alleles. The only Turner female in the study who had been previously ascribed a non-mosaic 45,X karyotype by using cytogenetic techniques, proved to be a cryptic mosaic, displaying two alleles of the genetic marker in the more sensitive molecular assay. These results suggest that in most cases 45,X/46,XX mosaicism in Turner females arises through loss of one of the X chromosomes in some cell lines in originally 46,XX conceptuses, rather than through mitotic non-disjunction during early embryogenesis in originally 45,X conceptuses. A high sensitivity of the modified assay based on PCR-amplification of the (CAG)n repeat within AR gene proves its usefulness as a tool for studying mosaicism in Turner syndrome.     

Identification and characterization of SirA, an iron-regulated protein from Staphylococcus aureus

The acquisition of iron by pathogenic bacteria is often a crucial step in establishing infection. To accomplish this, many bacteria, including Staphylococcus aureus, produce low-molecular-weight iron-chelating siderophores. However, the secretion and transport of these molecules in gram-positive organisms are poorly understood. The sequence, organization, and regulation of genes involved in siderophore transport are conserved among gram-negative bacteria. We used this information to identify a putative siderophore transport locus from an S. aureus genomic sequence database. This locus contains three predicted open reading frames with a high degree of homology to genes involved in siderophore uptake in several bacterial species, in particular the cbr locus of the plant pathogen Erwinia chrysanthemi. The first gene in the locus, which we have designated sir for staphylococcal iron regulated, encodes a putative lipoprotein with a molecular mass of 37 kDa. The open reading frame is preceded by a 19-bp region of dyad symmetry with homology for operator sequences controlling iron-regulated expression of genes in other bacteria. Fur titration experiments indicate that this region of dyad symmetry is sufficient for Fur-dependent regulation in Escherichia coli. The expression of this gene was repressed, in a dose-dependent manner, by the addition of iron to the S. aureus culture medium. sir-encoded proteins may be involved in iron acquisition in vivo and therefore may be targets for antimicrobial agents.     

Linking toluene degradation with specific microbial populations in soil

Phospholipid fatty acid (PLFA) analysis of a soil microbial community was coupled with (13)C isotope tracer analysis to measure the community's response to addition of 35 microg of [(13)C]toluene ml of soil solution(-1). After 119 h of incubation with toluene, 96% of the incorporated (13)C was detected in only 16 of the total 59 PLFAs (27%) extracted from the soil. Of the total (13)C-enriched PLFAs, 85% were identical to the PLFAs contained in a toluene-metabolizing bacterium isolated from the same soil. In contrast, the majority of the soil PLFAs (91%) became labeled when the same soil was incubated with [(13)C]glucose. Our study showed that coupling (13)C tracer analysis with PLFA analysis is an effective technique for distinguishing a specific microbial population involved in metabolism of a labeled substrate in complex environments such as soil.     

Altering Cellular Signaling Pathways Enhance Gene Silencing Activity of shRNA,shRNA.Ribozyme,and shRNA.Antisense in Neuroblastoma Cells

1. RNA interference (RNAi) is a multicomponent machinery that operates in a sequence-specific manner to repress the expression of genes in most eukaryotic cells.2. Here we wanted to investigate in a murine neuroblastoma cell line (NBP2) (a) if replacement of the loop of the short hairpin RNA (shRNA) with a hammerhead ribozyme (shRNA.RZ) or an antisense oligonucleotide (shRNA.AS) would affect the efficacy of gene suppression, and (b) if activation or inhibition of signaling pathways would enhance the efficacy of shRNA, shRNA.RZ, and shRNA.AS complex in gene silencing.3. We used U6-driven expression of these shRNAs to target either a short-lived green fluorescent protein (d2EGFP) or an endogenous cyclophilin A (CyP-A) gene in a d2EGFP expressing NBP2 cell line (NBP2-PN25).4. Activation of the cAMP signaling pathway or inhibition of phosphatidylinositol 3-kinase (PI3K) enhanced the efficacy of shRNA and shRNA.RZ complex in reducing the expression of d2EGFP shRNA.RZ complex was as efficacious as shRNA in reducing the expression of d2EGFP and CyP-A shRNA.AS complex showed a slightly lower efficacy than shRNA alone in decreasing d2EGFP expression. In contrast, the U6-driven hammerhead ribozyme targeted to d2EGFP showed no gene silencing activity.5. This report describes novel strategies of modifying shRNA and altering signaling pathways to affect siRNA-mediated gene silencing in a neuronal cell line.     

The luminous world of john and elisabeth buck

Highlights of the research careers of John and Elisabeth Buckare presented, illustrating their importance as investigatorsof firefly biology including taxonomy, morphology, physiologyand behavior, and as catalysts of collegial exchanges advancingprogress among investigators of bioluminescence in its widestaspects over the past 50 years.     

Apolipoprotein E promotes astrocyte colocalization and degradation of deposited amyloid-beta peptides

We have previously shown that apolipoprotein E (Apoe) promotes the formation of amyloid in brain and that astrocyte-specific expression of APOE markedly affects the deposition of amyloid-beta peptides (Abeta) in a mouse model of Alzheimer disease. Given the capacity of astrocytes to degrade Abeta, we investigated the potential role of Apoe in this astrocyte-mediated degradation. In contrast to cultured adult wild-type mouse astrocytes, adult Apoe(-/-) astrocytes do not degrade Abeta present in Abeta plaque-bearing brain sections in vitro. Coincubation with antibodies to either Apoe or Abeta, or with RAP, an antagonist of the low-density lipoprotein receptor family, effectively blocks Abeta degradation by astrocytes. Phase-contrast and confocal microscopy show that Apoe(-/-) astrocytes do not respond to or internalize Abeta deposits to the same extent as do wild-type astrocytes. Thus, Apoe seems to be important in the degradation and clearance of deposited Abeta species by astrocytes, a process that may be impaired in Alzheimer disease.     

First nuclear DNA C-values for 28 angiosperm genera

This paper reports first DNA C-values for 28 angiosperm genera. These include first DNA C-values for 25 families, of which 16 are monocots. Overall familial representation is 47.2 % for angiosperms, but is now much higher for monocots (75 %) and basal angiosperms (73.1 %) than for eudicots (38.7 %). Chromosome counts are reported for 22 taxa, including first records for six genera plus seven species. Unrepresented families will become increasingly enriched for monotypic taxa from obscure locations that are harder to access. Thus, completing familial representation for genome size for angiosperms may prove impossible in any short period, and progress towards this goal will become slower.     

Quinone reduction via secondary B-branch electron transfer in mutant bacterial reaction centers

Symmetry-related branches of electron-transfer cofactors-initiating with a primary electron donor (P) and terminating in quinone acceptors (Q)-are common features of photosynthetic reaction centers (RC). Experimental observations show activity of only one of them-the A branch-in wild-type bacterial RCs. In a mutant RC, we now demonstrate that electron transfer can occur along the entire, normally inactive B-branch pathway to reduce the terminal acceptor Q(B) on the time scale of nanoseconds. The transmembrane charge-separated state P(+)Q(B)(-) is created in this manner in a Rhodobacter capsulatus RC containing the F(L181)Y-Y(M208)F-L(M212)H-W(M250)V mutations (YFHV). The W(M250)V mutation quantitatively blocks binding of Q(A), thereby eliminating Q(B) reduction via the normal A-branch pathway. Full occupancy of the Q(B) site by the native UQ(10) is ensured (without the necessity of reconstitution by exogenous quinone) by purification of RCs with the mild detergent, Deriphat 160-C. The lifetime of P(+)Q(B)(-) in the YFHV mutant RC is >6 s (at pH 8.0, 298 K). This charge-separated state is not formed upon addition of competitive inhibitors of Q(B) binding (terbutryn or stigmatellin). Furthermore, this lifetime is much longer than the value of approximately 1-1.5 s found when P(+)Q(B)(-) is produced in the wild-type RC by A-side activity alone. Collectively, these results demonstrate that P(+)Q(B)(-) is formed solely by activity of the B-branch carriers in the YFHV RC. In comparison, P(+)Q(B)(-) can form by either the A or B branches in the YFH RC, as indicated by the biexponential lifetimes of approximately 1 and approximately 6-10 s. These findings suggest that P(+)Q(B)(-) states formed via the two branches are distinct and that P(+)Q(B)(-) formed by the B side does not decay via the normal (indirect) pathway that utilizes the A-side cofactors when present. These differences may report on structural and energetic factors that further distinguish the functional asymmetry of the two cofactor branches.     

Integrin alpha4beta1-dependent adhesion to ADAM 28 (MDC-L) requires an extended surface of the disintegrin domain

ADAMs (a disintegrin and metalloprotease) are a family of proteins that possess functional adhesive and proteolytic domains. ADAM 28 (MDC-L) is expressed by human lymphocytes and contains a disintegrin-like domain that serves as a ligand for the leukocyte integrin, alpha4beta1. To elucidate which residues comprise the alpha4beta1 binding site in the ADAM 28 disintegrin domain, a charge-to-alanine mutagenesis strategy was utilized. Each alanine substitution mutant was evaluated and compared to the native sequence for its ability to support cell adhesion of the T-lymphoma cell line, Jurkat. This approach identified ADAM 28 residues Lys(437), Lys(442), Lys(455), Lys(459), Lys(460), Lys(469), and Glu(476) as being essential for alpha4beta1-dependent cell adhesion. The epitope for a function-blocking monoclonal antibody, Dis 1-1, was localized to the N-terminal end of the ADAM 28 disintegrin domain using these same charge-to-alanine mutants. Three distinct molecular models based upon the known structures of snake venom disintegrins suggested that residues contributing to alpha4beta1 recognition are aligned on one face of the domain. This study demonstrates that residues located outside of the disintegrin loop participate in integrin recognition of mammalian disintegrins.