Biochemical and morphological characterization of a plasma membrane-enriched fraction from bovine parathyroid cells

A fraction of enriched plasma membranes from bovine parathyroid cells has been prepared by differential centrifugation. Biochemical characterization shows that this fraction has a specific activity enrichment of 7.2-fold in ouabain-sensitive Na+-K+ ATPase, and 3.5-fold in 5'-nucleotidase. Less than 4% of the total mitochondria and lysosomes are present within the plasma membranes, while microsomal contamination accounts for 14% of total specific activity. Parathyroid hormone radioimmunoassay also reveals the presence of some secretory granules within the plasma membrane fraction. The characteristic morphological aspect of the unusual surface membrane is shown by freeze-fracture electron microscopy. In the enriched pellets, vesicles identified as having a plasma membrane origin have variable sizes, and 50% show an inside-out conformation. Even though the plasma membrane fraction described herein is not absolutely free from contamination by other subcellular components, this protocol represents the first attempt to purify surface membrane from parathyroid tissue and provide the starting material for understanding, at a molecular level, the properties of extracellular Ca2+ regulation and its coupling with secretion of parathyroid hormone.     

Binding of a spin-labelled chlorpromazine analogue to calmodulin.

The binding of a spin-labelled derivative of chlorpromazine to calmodulin was investigated by e.s.r. spectrometry. The completion of the spectroscopic changes requires the presence of 4 Ca2+ ions per calmodulin molecule. The influences of various physicochemical factors (pH, ionic strength) are discussed in relation to the nature (hydrophobic and polar) of the interactions that hold the drug-calmodulin complex together.     

Cytochemical and electrophoretic studies of haemoglobin synthesis in the fat body of a midge, Chironomus thummi

The fat body of developing mid- and late fourth instar larvae of a midge, Chironomus thummi, has been investigated by means of the benzidine reaction for the localization of haemoglobin within cells. In the subepidermal fat body the reaction deposits of the haemoglobin pseudo-peroxidase activity appear predominantly in the intracisternal cavities of ER and the Golgi, and later, in the pharate pupal stage, in small dense granules (0.5–1 μm in. diameter).All the major protein bands of fat body extracts, which are resolved in electrophoresis, give the benzidine reaction and show incorporation of ¹⁴C-amino levulinic acids, in this case a specific marker for haemoglobin synthesis. In addition, labelled proteins show identical electrophoretic mobility as the haemoglobins of the haemolymph, suggesting that haemoglobins are synthesized in the fat body. Two types of fat body cells seem to differ with respect to their rôle in haemoglobin metabolism.     

Galactolipid synthesis in chromoplasts in vitro

Isolated chromoplasts from Narcissus pseudonarcissus flowers contain: a fatty acid synthesizing system; acyl-CoA synthetase (EC 6.2.1.3); glycero-phosphate acyltransferase (EC 2.3.1.15); acylglycero-phosphate acyltransferase; phosphatidate phosphatase (EC 3.1.3.4); diacylglycerol galactosyltransferase (EC 2.4.1.46); and diacylgalactosylglycerol galactosyltransferase, i.e. all enzymatic activities necessary for the synthesis of diacylgalactosylglycerol and diacylgalabiosylglycerol from acetate, HCO _- ³ , sn-glycerol 3-phosphate, and UDP-d-galactose. Diacylgalactosylglycerol and diacylgalabiosylglycerol, however, are synthesized from these precursors to only a very low extent in an in vitro system. This is attributed to a specificity of diacylglycerol galactosyltransferase for highly unsaturated diacylglycerols. Specificities of acyltransferase reactions were also found.     

The ultrastructure of the blood vessels of Branchiostoma lanceolatum (Pallas) (Cephalochordata)

Summary The ultrastructure of the blood vessels in the caudal region of Branchiostoma is described in specimens injected with indian ink. None of the vessels have endothelial cells delimiting the luminal surface. The vessels are delimited either by dense connective tissue or by the characteristic basement lamella underneath the basal lamina of the myocoelic epithelium. It is proposed that the main blood flow in the caudal region follows different pathways depending on the activity of the animal. During swimming the muscle activity of the caudal muscles may have the effect that more blood flows from the aorta to the myoseptal plexi and is drained to the caudal vessel. In the resting animal it is possible that the blood flow through the myosepta is insignificant, and that the caudal blood flow is more or less restricted to the direct connections between the aorta and the caudal vessel: the dorsoventral anastomosis and the segmental connecting vessels.Supported by a grant from the Danish Natural Science Research Council     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.