Synthesis and evaluation of novel daunomycin-phosphate-sulfate -β-glucuronide and -β-glucoside prodrugs for application in adept

The synthesis, antiproliferative effect and enzymatic hydrolysis of daunomycin-3′-N- and -4′-O-phosphate and -sulfate derivatives and of daunomycin-3′-N-CO-β-glucuronide and -β-glucoside, designed to be prodrugs in ADEPT are described. The phosphate derivatives were almost as toxic as the parent drug whereas the sulfates were not hydrolyzed by aryl sulfatases. Glucuronyl and glucosyl prodrugs were found to be useful for application in ADEPT.     

Cytochemical and electrophoretic studies of haemoglobin synthesis in the fat body of a midge, Chironomus thummi

The fat body of developing mid- and late fourth instar larvae of a midge, Chironomus thummi, has been investigated by means of the benzidine reaction for the localization of haemoglobin within cells. In the subepidermal fat body the reaction deposits of the haemoglobin pseudo-peroxidase activity appear predominantly in the intracisternal cavities of ER and the Golgi, and later, in the pharate pupal stage, in small dense granules (0.5–1 μm in. diameter).All the major protein bands of fat body extracts, which are resolved in electrophoresis, give the benzidine reaction and show incorporation of ¹⁴C-amino levulinic acids, in this case a specific marker for haemoglobin synthesis. In addition, labelled proteins show identical electrophoretic mobility as the haemoglobins of the haemolymph, suggesting that haemoglobins are synthesized in the fat body. Two types of fat body cells seem to differ with respect to their rôle in haemoglobin metabolism.     

Galactolipid synthesis in chromoplasts in vitro

Isolated chromoplasts from Narcissus pseudonarcissus flowers contain: a fatty acid synthesizing system; acyl-CoA synthetase (EC 6.2.1.3); glycero-phosphate acyltransferase (EC 2.3.1.15); acylglycero-phosphate acyltransferase; phosphatidate phosphatase (EC 3.1.3.4); diacylglycerol galactosyltransferase (EC 2.4.1.46); and diacylgalactosylglycerol galactosyltransferase, i.e. all enzymatic activities necessary for the synthesis of diacylgalactosylglycerol and diacylgalabiosylglycerol from acetate, HCO _- ³ , sn-glycerol 3-phosphate, and UDP-d-galactose. Diacylgalactosylglycerol and diacylgalabiosylglycerol, however, are synthesized from these precursors to only a very low extent in an in vitro system. This is attributed to a specificity of diacylglycerol galactosyltransferase for highly unsaturated diacylglycerols. Specificities of acyltransferase reactions were also found.     

The ultrastructure of the blood vessels of Branchiostoma lanceolatum (Pallas) (Cephalochordata)

Summary The ultrastructure of the blood vessels in the caudal region of Branchiostoma is described in specimens injected with indian ink. None of the vessels have endothelial cells delimiting the luminal surface. The vessels are delimited either by dense connective tissue or by the characteristic basement lamella underneath the basal lamina of the myocoelic epithelium. It is proposed that the main blood flow in the caudal region follows different pathways depending on the activity of the animal. During swimming the muscle activity of the caudal muscles may have the effect that more blood flows from the aorta to the myoseptal plexi and is drained to the caudal vessel. In the resting animal it is possible that the blood flow through the myosepta is insignificant, and that the caudal blood flow is more or less restricted to the direct connections between the aorta and the caudal vessel: the dorsoventral anastomosis and the segmental connecting vessels.Supported by a grant from the Danish Natural Science Research Council     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Immunocytochemical identification of proctolinlike immunoreactivity in the terminal ganglion and hindgut of the cockroach Periplaneta americana (L.)

Summary In the American cockroach, the distribution and connections of neuronal elements of the terminal ganglion-proctodeal nerve-hindgut system were investigated by means of immunohistochemical methods and axonal CoCl₂ iontophoresis. Proctolinlike immunoreactivity was localized within neurons of the terminal ganglion projecting into the proctodeal nerve on the one hand, and in nerve cells without a direct connection to this system on the other. Immunohistochemically, in whole mount preparations fibres of the proctodeal nerve and terminal structures in the hindgut musculature exhibit strong proctolinlike immunoreactivity. At the light- and electron-microscopic levels the pathways of about 30 somata of the proctodeal neural system were characterized by cobalt chloride iontophoresis. The relationships of cobalt filled and immunoreactive neuronal structures are discussed.For the preparation of tritiated proctolin we thank Dr. S. Reißmann, WB Biochemie, Sektion Biologie, FSU JenaThe authors wish to thank G. Schörlitz, Film- und Bildstelle, FSU Jena, for photographs of whole mount preparations and Ms. A. Zinßer and Mrs. B. Cosack for excellent technical assistance.