The physiological significance of cyanide-resistant respiration in higher plants

Abstract A brief survey of the biochemistry of the alternative oxidative pathway (‘cyanide-resistant respiration’) and its occurrence in vivo is given. Several hypotheses about the physiological significance of the alternative chain are discussed. These include a role in (1) heat production, (2) fruit ripening, (3) respiration of plants that contain high levels of cyanogenic glycosides, producing HCN upon wounding, (4) oxidation of NADH that is produced by various causes in excess of that required for ATP production, (5) ion uptake, and (6) osmoregulation. In intact roots of higher plants, the activity of the alternative pathway is more active when less carbohydrate is required for assimilation of N (NH+₄ NO-₃ or N₂) and is less active in those when carbohydrates are being stored in a storage organ or when the availability of photosynthate is reduced. An increase in carbohydrate requirement for osmoregulation is also correlated with decreased alternative chain activity. It is concluded that the alternative pathway in roots plays an important role in oxidation of sugars which are not required for carbon skeletons, energy production for growth and maintenance processes, osmoregulation or storage. However, the significance of this role may vary in different tissues and physiological states.     

Galactolipid synthesis in chromoplasts in vitro

Isolated chromoplasts from Narcissus pseudonarcissus flowers contain: a fatty acid synthesizing system; acyl-CoA synthetase (EC 6.2.1.3); glycero-phosphate acyltransferase (EC 2.3.1.15); acylglycero-phosphate acyltransferase; phosphatidate phosphatase (EC 3.1.3.4); diacylglycerol galactosyltransferase (EC 2.4.1.46); and diacylgalactosylglycerol galactosyltransferase, i.e. all enzymatic activities necessary for the synthesis of diacylgalactosylglycerol and diacylgalabiosylglycerol from acetate, HCO _- ³ , sn-glycerol 3-phosphate, and UDP-d-galactose. Diacylgalactosylglycerol and diacylgalabiosylglycerol, however, are synthesized from these precursors to only a very low extent in an in vitro system. This is attributed to a specificity of diacylglycerol galactosyltransferase for highly unsaturated diacylglycerols. Specificities of acyltransferase reactions were also found.     

The ultrastructure of the blood vessels of Branchiostoma lanceolatum (Pallas) (Cephalochordata)

Summary The ultrastructure of the blood vessels in the caudal region of Branchiostoma is described in specimens injected with indian ink. None of the vessels have endothelial cells delimiting the luminal surface. The vessels are delimited either by dense connective tissue or by the characteristic basement lamella underneath the basal lamina of the myocoelic epithelium. It is proposed that the main blood flow in the caudal region follows different pathways depending on the activity of the animal. During swimming the muscle activity of the caudal muscles may have the effect that more blood flows from the aorta to the myoseptal plexi and is drained to the caudal vessel. In the resting animal it is possible that the blood flow through the myosepta is insignificant, and that the caudal blood flow is more or less restricted to the direct connections between the aorta and the caudal vessel: the dorsoventral anastomosis and the segmental connecting vessels.Supported by a grant from the Danish Natural Science Research Council     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Immunocytochemical identification of proctolinlike immunoreactivity in the terminal ganglion and hindgut of the cockroach Periplaneta americana (L.)

Summary In the American cockroach, the distribution and connections of neuronal elements of the terminal ganglion-proctodeal nerve-hindgut system were investigated by means of immunohistochemical methods and axonal CoCl₂ iontophoresis. Proctolinlike immunoreactivity was localized within neurons of the terminal ganglion projecting into the proctodeal nerve on the one hand, and in nerve cells without a direct connection to this system on the other. Immunohistochemically, in whole mount preparations fibres of the proctodeal nerve and terminal structures in the hindgut musculature exhibit strong proctolinlike immunoreactivity. At the light- and electron-microscopic levels the pathways of about 30 somata of the proctodeal neural system were characterized by cobalt chloride iontophoresis. The relationships of cobalt filled and immunoreactive neuronal structures are discussed.For the preparation of tritiated proctolin we thank Dr. S. Reißmann, WB Biochemie, Sektion Biologie, FSU JenaThe authors wish to thank G. Schörlitz, Film- und Bildstelle, FSU Jena, for photographs of whole mount preparations and Ms. A. Zinßer and Mrs. B. Cosack for excellent technical assistance.     

Ectothiorhodospira vacuolata sp. nov., a new phototrophic bacterium from soda lakes

A new phototrophic bacterium was isolated from Jordanian and Kenyan alkaline salt lakes. Cells are rod shaped, 1.5 m wide and 2–4 m long, and motile by polar flagella. They divide by binary fission, and possess photosynthetic membranes as lamellar stacks similar to those in the other species of the genus Ectothiorhodospira and the brown colored Rhodospirillum species. The presence of bacteriochlorophyll a and carotenoids of the normal spirilloxanthin series is indicated by the absorption spectra of living cells. Under certain growth conditions the cells form gas vacuoles, may become immotile and float to the top of the culture medium. Sulfide and thiosulfate are used as photosynthetic electron donors. During the oxidation of sulfide to sulfate, elemental sulfur is formed, which is accumulated outside the cells. The organisms are strictly anaerobic, do not require vitamins, are moderately halophilic and need alkaline pH-values for growth. The new species Ectothiorhodospira vacuolata is proposed.