The ultrastructure of the blood vessels of Branchiostoma lanceolatum (Pallas) (Cephalochordata)

Summary The ultrastructure of the blood vessels in the caudal region of Branchiostoma is described in specimens injected with indian ink. None of the vessels have endothelial cells delimiting the luminal surface. The vessels are delimited either by dense connective tissue or by the characteristic basement lamella underneath the basal lamina of the myocoelic epithelium. It is proposed that the main blood flow in the caudal region follows different pathways depending on the activity of the animal. During swimming the muscle activity of the caudal muscles may have the effect that more blood flows from the aorta to the myoseptal plexi and is drained to the caudal vessel. In the resting animal it is possible that the blood flow through the myosepta is insignificant, and that the caudal blood flow is more or less restricted to the direct connections between the aorta and the caudal vessel: the dorsoventral anastomosis and the segmental connecting vessels.Supported by a grant from the Danish Natural Science Research Council     

A severe and a mild potato spindle tuber viroid isolate differ in three nucleotide exchanges only

Fingerprint analyses of two potato spindle tuber viroid (PSTV) isolates causing severe and mild symptoms~ respectively, in tomato exhibited defined differences in the RNase T₁ and RNase A fingerprints. The complete sequencing of the mild isolate and the comparison of its primary structure with the previously established one of the pathogenic type strain revealed that oligonucleotides CAAAAAAG, CUUUUUCUCUAUCUUACUUG, and AAAAAAGGAC in the severe strain are replaced by CAAUAAG, CUUUUUCUCUAUCUUUCUUUG, AAU, and AAGGAC in the 'mild' strain. Thus, three nucleotide exchanges at different sites of the molecule may change a pathogenic viroid to a practically non-pathogenic isolate. The possible correlation between the secondary structure in a defined region of the PSTV molecule and its pathogenicity for tomato is discussed.     

Immunocytochemical identification of proctolinlike immunoreactivity in the terminal ganglion and hindgut of the cockroach Periplaneta americana (L.)

Summary In the American cockroach, the distribution and connections of neuronal elements of the terminal ganglion-proctodeal nerve-hindgut system were investigated by means of immunohistochemical methods and axonal CoCl₂ iontophoresis. Proctolinlike immunoreactivity was localized within neurons of the terminal ganglion projecting into the proctodeal nerve on the one hand, and in nerve cells without a direct connection to this system on the other. Immunohistochemically, in whole mount preparations fibres of the proctodeal nerve and terminal structures in the hindgut musculature exhibit strong proctolinlike immunoreactivity. At the light- and electron-microscopic levels the pathways of about 30 somata of the proctodeal neural system were characterized by cobalt chloride iontophoresis. The relationships of cobalt filled and immunoreactive neuronal structures are discussed.For the preparation of tritiated proctolin we thank Dr. S. Reißmann, WB Biochemie, Sektion Biologie, FSU JenaThe authors wish to thank G. Schörlitz, Film- und Bildstelle, FSU Jena, for photographs of whole mount preparations and Ms. A. Zinßer and Mrs. B. Cosack for excellent technical assistance.     

The diffusion of gibberellins into agar and water during early germination of Pharbitis nil Choisy

Agar diffusion of imbibed seeds yielded significant amounts of diffusible Gibberellin-like substances. An analysis of the extractable and diffusible gibberellin-like substance, including an analysis of the remaining imbibition water of the seeds, indicated that a significant part of these gibberellin-like substances could be attributed to a net biosynthesis of these substances in the imbibing seeds. At the same time it was found that water diffusion yielded considerably more gibberellin-like activities than comparable agar diffusions i.e. 10 to 12 fold in general.Agar as well as water diffusion showed a temperature effect with regard to the yield of gibberellin-like substances particularly during the first 6 h of diffusion. The yield of these substances is lower at 10°C, and remains lower as shown with consecutive diffusions, in comparison with the yields at 20°C or 30°C.With both agar and water diffusion the sum of activities obtained with consecutive diffusions is always higher, often considerably higher, than equal periods of continuous diffusion which is probably due to inactivation and/or interference of inhibitory substances with the bioassay responses. Finally, water diffusates of both seeds and seedlings of the normal growing cv. Violet of Japanese morning glory contained considerably more gibberellin-like activities than those of the dwarf cv. Kidachi which indicated that normals synthesize more gibberellins than dwarfs.     

The multiple forms of brain acetylcholinesterase

Summary Micro-polyacrylamide gradient electrophoresis followed by active staining is applied for the demonstration of the multiple forms of acetylcholinesterase. Among other advantages the very small samples that enable the analysis of well-defined brain material as well as the almost histochemical conditions of incubation enable its successful use in topochemical investigations of the multiple form pattern of brain acetylcholinesterase.The acetylcholinesterase of bovine nc. caudatus could be separated into 4 multiple forms and the pattern was analysed microdensitometrically. These forms differ in their molecular weight as well as well as in their degree of membrane binding. Increasing ionic strength (NaCl) is followed by changes in the pattern. This result is discussed as caused by aggregation of enzyme subunits.The research reported in this paper was supported by the Ministerium für Wissenschaft und Technik der DDR     

Purification and properties of mannitol dehydrogenase from Agaricus bisporus sporocarps

Mannitol dehydrogenase (mannitol: NADP⁺ 2-oxidoreductase: EC 1.1.1.138) was isolated from Agaricus bisporus by fractionation with protamine sulphate and (NH₄)₂SO₄, followed by chromatography on DEAE-Sephadex, then by affinity and gel chromatography. The products of enzyme reaction were identified by GLC and TLC. K_m, optimum pH, MW and pI of the enzyme as well as the influence of temperature, ions and inhibitors on enzymic activity were determined. In the sugar reducing reaction, the enzyme was specific for fructose but, in the reverse direction, some structurally related polyols could substitute for mannitol. The enzyme was very sensitive to alterations in the NADP⁺/NADPH ratio. The results are discussed in relation to the possible role of mannitol dehydrogenase in fungal metabolism.